Difference between revisions of "Ipomoea batatas"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
  
[[File:Ipomoea batatas-1.jpg|right|327px|]]
+
[[File:Ipomoea batatas-1.png|right|327px|]]
 
* Sweetpotato [Ipomoea batatas (L.) Lam] is, together with cassava, one of the most important commercial and nutritional root crops in Asia. It is used not only as a major food source but also as an important industrial raw material for animal feed, alcohol production and antioxidant pigment syntheses, including anthocyanins and carotenoids. Recently, new varieties of colored sweetpotatoes, including yellow-fleshed and purple-fleshed varieties with higher carotenoid and anthocyanin contents and desirable nutritional and physiological properties, have been introduced<ref name="ref1"/> <ref name="ref2"/>.
 
* Sweetpotato [Ipomoea batatas (L.) Lam] is, together with cassava, one of the most important commercial and nutritional root crops in Asia. It is used not only as a major food source but also as an important industrial raw material for animal feed, alcohol production and antioxidant pigment syntheses, including anthocyanins and carotenoids. Recently, new varieties of colored sweetpotatoes, including yellow-fleshed and purple-fleshed varieties with higher carotenoid and anthocyanin contents and desirable nutritional and physiological properties, have been introduced<ref name="ref1"/> <ref name="ref2"/>.
  

Revision as of 07:56, 17 June 2017

Description

Ipomoea batatas-1.png
  • Sweetpotato [Ipomoea batatas (L.) Lam] is, together with cassava, one of the most important commercial and nutritional root crops in Asia. It is used not only as a major food source but also as an important industrial raw material for animal feed, alcohol production and antioxidant pigment syntheses, including anthocyanins and carotenoids. Recently, new varieties of colored sweetpotatoes, including yellow-fleshed and purple-fleshed varieties with higher carotenoid and anthocyanin contents and desirable nutritional and physiological properties, have been introduced[1] [2].

Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ARF[1] ADP-ribosylation factor
  • abiotic Stress
JX177359
  • F:CTTTGCCAAGAAGGAGATGC
  • R:TCTTGTCCTGACCACCAACA
185 60 SYBR
UBI[1] ubiquitin extension protein
  • abiotic Stress
JX177358
  • F:TCGACAATGTGAAGGCAAAG
  • R:CTTGATCTTCTTCGGCTTGG
209 60 SYBR
COX[1] cytochrome c oxidase subunit Vc
  • abiotic Stress
S73602.1
  • F:ACTGGAACAGCCAGAGGAGA
  • R:ATGCAATCTTCCATGGGTTC
159 60 SYBR
GAP[1] glyceraldehyde-3-phosphate dehydrogenase
  • abiotic Stress
JX177362
  • F:ATACTGTGCACGGACAATGG
  • R:TCAGCCCATGGAATCTCTTC
124 60 SYBR
RPL[1] ribosomal protein L2
  • abiotic Stress
AY596742.1
  • F:TTTGACCGAAATGCCCTTAG
  • R:TTCTGGTTCACCCCAACATT
160 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Sung-Chul Park
  • Email: sskwak@kribb.re.kr
  • Institute: Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, Republic of Korea

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Park S C, Kim Y H, Ji C Y, et al. Stable internal reference genes for the normalization of real-time PCR in different sweetpotato cultivars subjected to abiotic stress conditions[J]. PloS one, 2012, 7(12): e51502.
  2. Chuaqui RF, Bonner RF, Best CJM, Gillespie JW, Flaig MJ, et al. (2002) Postanalysis follow-up and validation of microarray experiments. Nat Genet 32:509–514.