Difference between revisions of "Ipomoea batatas"

From ICG
Jump to navigation Jump to search
 
(6 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Ipomoea batatas-1.png|right|327px|]]
+
[[File:Ipomoea batatas.png|right|200px|link=Ipomoea batatas]]
 
* '''''Ipomoea batatas (L.) Lam''''', together with cassava, is one of the most important commercial and nutritional root crops in Asia. It is used not only as a major food source but also as an important industrial raw material for animal feed, alcohol production and antioxidant pigment syntheses, including anthocyanins and carotenoids. New varieties of colored sweetpotatoes with higher carotenoid and anthocyanin contents and desirable nutritional and physiological properties, have been introduced<ref name="ref1"/><ref name="ref2"/>.
 
* '''''Ipomoea batatas (L.) Lam''''', together with cassava, is one of the most important commercial and nutritional root crops in Asia. It is used not only as a major food source but also as an important industrial raw material for animal feed, alcohol production and antioxidant pigment syntheses, including anthocyanins and carotenoids. New varieties of colored sweetpotatoes with higher carotenoid and anthocyanin contents and desirable nutritional and physiological properties, have been introduced<ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Sweet potato '''
 
* <font color=blue>'''Common Name:'''</font> '''Sweet potato '''
Line 6: Line 6:
  
 
=='''''Abiotic Stress'''''==
 
=='''''Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 21: Line 21:
 
|align="center"| ADP-ribosylation factor  
 
|align="center"| ADP-ribosylation factor  
 
|
 
|
* Abiotic stress
+
* Cold, drought, salt and oxidative stress
 +
* Mature leaves, vine tip
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177359 '''JX177359''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177359 '''JX177359''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 34:
 
|align="center"| Ubiquitin extension protein  
 
|align="center"| Ubiquitin extension protein  
 
|
 
|
* Abiotic stress
+
* Cold, drought, salt and oxidative stress
 +
* Mature leaves, vine tip
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177358 '''JX177358 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177358 '''JX177358 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 47:
 
|align="center"| Cytochrome c oxidase subunit Vc  
 
|align="center"| Cytochrome c oxidase subunit Vc  
 
|
 
|
* Abiotic stress
+
* Cold, drought, salt and oxidative stress
 +
* Mature leaves, vine tip
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/S73602.1 '''S73602.1''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/S73602.1 '''S73602.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 57: Line 60:
 
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
* Abiotic stress
+
* Cold, drought, salt and oxidative stress
 +
* Mature leaves, vine tip
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177362 '''JX177362 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177362 '''JX177362 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 69: Line 73:
 
|align="center"| Ribosomal protein L2
 
|align="center"| Ribosomal protein L2
 
|
 
|
* Abiotic stress
+
* Cold, drought, salt and oxidative stress
 +
* Mature leaves, vine tip
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/AY596742.1 '''AY596742.1 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/AY596742.1 '''AY596742.1 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 91: Line 96:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''22''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=4018428289758601971&as_sdt=2005&sciodt=0,5&hl=en'''24'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 102: Line 107:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
  
 
[[Category:SYBR]]
 
[[Category:SYBR]]
[[Category:ARF]] [[Category:COX]] [[Category:GAPDH]] [[Category:RPL]] [[Category:Ubiquitin]]
+
[[Category:ARF]] [[Category:Cyclophilin]] [[Category:GAPDH]] [[Category:RPL]] [[Category:Ubiquitin]]
 
[[Category:Abiotic Stress]]
 
[[Category:Abiotic Stress]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 06:55, 1 September 2017

Description

Ipomoea batatas.png
  • Ipomoea batatas (L.) Lam, together with cassava, is one of the most important commercial and nutritional root crops in Asia. It is used not only as a major food source but also as an important industrial raw material for animal feed, alcohol production and antioxidant pigment syntheses, including anthocyanins and carotenoids. New varieties of colored sweetpotatoes with higher carotenoid and anthocyanin contents and desirable nutritional and physiological properties, have been introduced[1][2].
  • Common Name: Sweet potato
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ARF[1] ADP-ribosylation factor
  • Cold, drought, salt and oxidative stress
  • Mature leaves, vine tip
JX177359
  • F:CTTTGCCAAGAAGGAGATGC
  • R:TCTTGTCCTGACCACCAACA
185 60 SYBR
UBI[1] Ubiquitin extension protein
  • Cold, drought, salt and oxidative stress
  • Mature leaves, vine tip
JX177358
  • F:TCGACAATGTGAAGGCAAAG
  • R:CTTGATCTTCTTCGGCTTGG
209 60 SYBR
COX[1] Cytochrome c oxidase subunit Vc
  • Cold, drought, salt and oxidative stress
  • Mature leaves, vine tip
S73602.1
  • F:ACTGGAACAGCCAGAGGAGA
  • R:ATGCAATCTTCCATGGGTTC
159 60 SYBR
GAP[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Cold, drought, salt and oxidative stress
  • Mature leaves, vine tip
JX177362
  • F:ATACTGTGCACGGACAATGG
  • R:TCAGCCCATGGAATCTCTTC
124 60 SYBR
RPL[1] Ribosomal protein L2
  • Cold, drought, salt and oxidative stress
  • Mature leaves, vine tip
AY596742.1
  • F:TTTGACCGAAATGCCCTTAG
  • R:TTCTGGTTCACCCCAACATT
160 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sung-Chul Park
  • Email: sskwak@kribb.re.kr
  • Institution: Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, Republic of Korea

Citation Statistics

Cited by 24 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Park S C, Kim Y H, Ji C Y, et al. Stable internal reference genes for the normalization of real-time PCR in different sweetpotato cultivars subjected to abiotic stress conditions[J]. PloS one, 2012, 7(12): e51502.
  2. Chuaqui RF, Bonner RF, Best CJM, Gillespie JW, Flaig MJ, et al. (2002) Postanalysis follow-up and validation of microarray experiments. Nat Genet 32:509–514.

Categories