Difference between revisions of "Ipomoea batatas"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Abiotic Stress'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! styl...")
 
 
(21 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Ipomoea batatas.png|right|200px|link=Ipomoea batatas]]
 +
* '''''Ipomoea batatas (L.) Lam''''', together with cassava, is one of the most important commercial and nutritional root crops in Asia. It is used not only as a major food source but also as an important industrial raw material for animal feed, alcohol production and antioxidant pigment syntheses, including anthocyanins and carotenoids. New varieties of colored sweetpotatoes with higher carotenoid and anthocyanin contents and desirable nutritional and physiological properties, have been introduced<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Sweet potato '''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4120 <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
=='''''Abiotic Stress'''''==
 
=='''''Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 8: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 16: Line 21:
 
|align="center"| ADP-ribosylation factor  
 
|align="center"| ADP-ribosylation factor  
 
|
 
|
* abiotic Stress
+
* Cold, drought, salt and oxidative stress
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177359''JX177359''']  
+
* Mature leaves, vine tip
 +
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177359 '''JX177359''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CTTTGCCAAGAAGGAGATGC
 
* F:CTTTGCCAAGAAGGAGATGC
Line 26: Line 32:
 
|-
 
|-
 
|align="center"| UBI<ref name="ref1"/>
 
|align="center"| UBI<ref name="ref1"/>
|align="center"| ubiquitin extension protein  
+
|align="center"| Ubiquitin extension protein  
 
|
 
|
* abiotic Stress
+
* Cold, drought, salt and oxidative stress
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177358''JX177358 ''']  
+
* Mature leaves, vine tip
 +
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177358 '''JX177358 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TCGACAATGTGAAGGCAAAG  
 
* F:TCGACAATGTGAAGGCAAAG  
Line 38: Line 45:
 
|-
 
|-
 
|align="center"| COX<ref name="ref1"/>
 
|align="center"| COX<ref name="ref1"/>
|align="center"| cytochrome c oxidase subunit Vc  
+
|align="center"| Cytochrome c oxidase subunit Vc  
 
|
 
|
* abiotic Stress
+
* Cold, drought, salt and oxidative stress
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/S73602.1''S73602.1''']  
+
* Mature leaves, vine tip
 +
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/S73602.1 '''S73602.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ACTGGAACAGCCAGAGGAGA
 
* F:ACTGGAACAGCCAGAGGAGA
Line 50: Line 58:
 
|-
 
|-
 
|align="center"| GAP<ref name="ref1"/>
 
|align="center"| GAP<ref name="ref1"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
* abiotic Stress
+
* Cold, drought, salt and oxidative stress
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177362'‘JX177362 ''']  
+
* Mature leaves, vine tip
 +
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177362 '''JX177362 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ATACTGTGCACGGACAATGG
 
* F:ATACTGTGCACGGACAATGG
Line 62: Line 71:
 
|-
 
|-
 
|align="center"| RPL<ref name="ref1"/>
 
|align="center"| RPL<ref name="ref1"/>
|align="center"| ribosomal protein L2
+
|align="center"| Ribosomal protein L2
 
|
 
|
* abiotic Stress
+
* Cold, drought, salt and oxidative stress
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/AY596742.1''AY596742.1 ''']  
+
* Mature leaves, vine tip
 +
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/AY596742.1 '''AY596742.1 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TTTGACCGAAATGCCCTTAG
 
* F:TTTGACCGAAATGCCCTTAG
Line 73: Line 83:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer types===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 81: Line 93:
 
*'''Name''': Sung-Chul Park
 
*'''Name''': Sung-Chul Park
 
*'''Email''':  sskwak@kribb.re.kr
 
*'''Email''':  sskwak@kribb.re.kr
*'''Institute''': Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, Republic of Korea
+
*'''Institution''': Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, Republic of Korea
 +
 
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=4018428289758601971&as_sdt=2005&sciodt=0,5&hl=en'''24'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 87: Line 102:
 
<ref name="ref1">
 
<ref name="ref1">
 
Park S C, Kim Y H, Ji C Y, et al. Stable internal reference genes for the normalization of real-time PCR in different sweetpotato cultivars subjected to abiotic stress conditions[J]. PloS one, 2012, 7(12): e51502.
 
Park S C, Kim Y H, Ji C Y, et al. Stable internal reference genes for the normalization of real-time PCR in different sweetpotato cultivars subjected to abiotic stress conditions[J]. PloS one, 2012, 7(12): e51502.
 +
</ref>
 +
<ref name="ref2">
 +
Chuaqui RF, Bonner RF, Best CJM, Gillespie JW, Flaig MJ, et al. (2002) Postanalysis follow-up and validation of microarray experiments. Nat Genet 32:509–514.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 +
[[Category:Plants]]
 +
[[Category:mRNA]]
 +
 +
[[Category:SYBR]]
 +
[[Category:ARF]] [[Category:Cyclophilin]] [[Category:GAPDH]] [[Category:RPL]] [[Category:Ubiquitin]]
 +
[[Category:Abiotic Stress]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 06:55, 1 September 2017

Description

Ipomoea batatas.png
  • Ipomoea batatas (L.) Lam, together with cassava, is one of the most important commercial and nutritional root crops in Asia. It is used not only as a major food source but also as an important industrial raw material for animal feed, alcohol production and antioxidant pigment syntheses, including anthocyanins and carotenoids. New varieties of colored sweetpotatoes with higher carotenoid and anthocyanin contents and desirable nutritional and physiological properties, have been introduced[1][2].
  • Common Name: Sweet potato
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ARF[1] ADP-ribosylation factor
  • Cold, drought, salt and oxidative stress
  • Mature leaves, vine tip
JX177359
  • F:CTTTGCCAAGAAGGAGATGC
  • R:TCTTGTCCTGACCACCAACA
185 60 SYBR
UBI[1] Ubiquitin extension protein
  • Cold, drought, salt and oxidative stress
  • Mature leaves, vine tip
JX177358
  • F:TCGACAATGTGAAGGCAAAG
  • R:CTTGATCTTCTTCGGCTTGG
209 60 SYBR
COX[1] Cytochrome c oxidase subunit Vc
  • Cold, drought, salt and oxidative stress
  • Mature leaves, vine tip
S73602.1
  • F:ACTGGAACAGCCAGAGGAGA
  • R:ATGCAATCTTCCATGGGTTC
159 60 SYBR
GAP[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Cold, drought, salt and oxidative stress
  • Mature leaves, vine tip
JX177362
  • F:ATACTGTGCACGGACAATGG
  • R:TCAGCCCATGGAATCTCTTC
124 60 SYBR
RPL[1] Ribosomal protein L2
  • Cold, drought, salt and oxidative stress
  • Mature leaves, vine tip
AY596742.1
  • F:TTTGACCGAAATGCCCTTAG
  • R:TTCTGGTTCACCCCAACATT
160 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sung-Chul Park
  • Email: sskwak@kribb.re.kr
  • Institution: Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, Republic of Korea

Citation Statistics

Cited by 24 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Park S C, Kim Y H, Ji C Y, et al. Stable internal reference genes for the normalization of real-time PCR in different sweetpotato cultivars subjected to abiotic stress conditions[J]. PloS one, 2012, 7(12): e51502.
  2. Chuaqui RF, Bonner RF, Best CJM, Gillespie JW, Flaig MJ, et al. (2002) Postanalysis follow-up and validation of microarray experiments. Nat Genet 32:509–514.

Categories