Difference between revisions of "Ipomoea batatas"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Abiotic Stress'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! styl...")
 
Line 17: Line 17:
 
|
 
|
 
* abiotic Stress
 
* abiotic Stress
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177359''JX177359''']  
+
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177359 '''JX177359''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CTTTGCCAAGAAGGAGATGC
 
* F:CTTTGCCAAGAAGGAGATGC
Line 29: Line 29:
 
|
 
|
 
* abiotic Stress
 
* abiotic Stress
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177358''JX177358 ''']  
+
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177358 '''JX177358 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TCGACAATGTGAAGGCAAAG  
 
* F:TCGACAATGTGAAGGCAAAG  
Line 41: Line 41:
 
|
 
|
 
* abiotic Stress
 
* abiotic Stress
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/S73602.1''S73602.1''']  
+
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/S73602.1 '''S73602.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ACTGGAACAGCCAGAGGAGA
 
* F:ACTGGAACAGCCAGAGGAGA
Line 53: Line 53:
 
|
 
|
 
* abiotic Stress
 
* abiotic Stress
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177362'‘JX177362 ''']  
+
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JX177362 '''JX177362 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ATACTGTGCACGGACAATGG
 
* F:ATACTGTGCACGGACAATGG
Line 65: Line 65:
 
|
 
|
 
* abiotic Stress
 
* abiotic Stress
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/AY596742.1''AY596742.1 ''']  
+
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/AY596742.1 '''AY596742.1 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TTTGACCGAAATGCCCTTAG
 
* F:TTTGACCGAAATGCCCTTAG
Line 73: Line 73:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
 +
 
===Moleculer types===
 
===Moleculer types===
 
* mRNA
 
* mRNA

Revision as of 03:49, 17 June 2017

Description

Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ARF[1] ADP-ribosylation factor
  • abiotic Stress
JX177359
  • F:CTTTGCCAAGAAGGAGATGC
  • R:TCTTGTCCTGACCACCAACA
185 60 SYBR
UBI[1] ubiquitin extension protein
  • abiotic Stress
JX177358
  • F:TCGACAATGTGAAGGCAAAG
  • R:CTTGATCTTCTTCGGCTTGG
209 60 SYBR
COX[1] cytochrome c oxidase subunit Vc
  • abiotic Stress
S73602.1
  • F:ACTGGAACAGCCAGAGGAGA
  • R:ATGCAATCTTCCATGGGTTC
159 60 SYBR
GAP[1] glyceraldehyde-3-phosphate dehydrogenase
  • abiotic Stress
JX177362
  • F:ATACTGTGCACGGACAATGG
  • R:TCAGCCCATGGAATCTCTTC
124 60 SYBR
RPL[1] ribosomal protein L2
  • abiotic Stress
AY596742.1
  • F:TTTGACCGAAATGCCCTTAG
  • R:TTCTGGTTCACCCCAACATT
160 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Sung-Chul Park
  • Email: sskwak@kribb.re.kr
  • Institute: Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, Republic of Korea

References

  1. 1.0 1.1 1.2 1.3 1.4 Park S C, Kim Y H, Ji C Y, et al. Stable internal reference genes for the normalization of real-time PCR in different sweetpotato cultivars subjected to abiotic stress conditions[J]. PloS one, 2012, 7(12): e51502.