Ipomoea batatas

Description

Sweetpotato [Ipomoea batatas (L.) Lam] is, together with cassava, one of the most important commercial and nutritional root crops in Asia. It is used not only as a major food source but also as an important industrial raw material for animal feed, alcohol production and antioxidant pigment syntheses, including anthocyanins and carotenoids. Recently, new varieties of colored sweetpotatoes, including yellow-fleshed and purple-fleshed varieties with higher carotenoid and anthocyanin contents and desirable nutritional and physiological properties, have been introduced^[1] ^[2].

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
ARF^[1]	ADP-ribosylation factor	Abiotic stress	JX177359	F:CTTTGCCAAGAAGGAGATGC R:TCTTGTCCTGACCACCAACA	185	60	SYBR
UBI^[1]	Ubiquitin extension protein	Abiotic stress	JX177358	F:TCGACAATGTGAAGGCAAAG R:CTTGATCTTCTTCGGCTTGG	209	60	SYBR
COX^[1]	Cytochrome c oxidase subunit Vc	Abiotic stress	S73602.1	F:ACTGGAACAGCCAGAGGAGA R:ATGCAATCTTCCATGGGTTC	159	60	SYBR
GAP^[1]	Glyceraldehyde-3-phosphate dehydrogenase	Abiotic stress	JX177362	F:ATACTGTGCACGGACAATGG R:TCAGCCCATGGAATCTCTTC	124	60	SYBR
RPL^[1]	Ribosomal protein L2	Abiotic stress	AY596742.1	F:TTTGACCGAAATGCCCTTAG R:TTCTGGTTCACCCCAACATT	160	60	SYBR

Name: Sung-Chul Park
Email: sskwak@kribb.re.kr
Institution: Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, Republic of Korea

Cited by 22 (Based on Google Scholar [2017-06-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 Park S C, Kim Y H, Ji C Y, et al. Stable internal reference genes for the normalization of real-time PCR in different sweetpotato cultivars subjected to abiotic stress conditions[J]. PloS one, 2012, 7(12): e51502.
↑ Chuaqui RF, Bonner RF, Best CJM, Gillespie JW, Flaig MJ, et al. (2002) Postanalysis follow-up and validation of microarray experiments. Nat Genet 32:509–514.