Ipomoea batatas

From ICG
Revision as of 03:49, 17 June 2017 by Xysj2012 (talk | contribs) (Created page with "=='''Description'''== =='''''Abiotic Stress'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! styl...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ARF[1] ADP-ribosylation factor
  • abiotic Stress
JX177359'
  • F:CTTTGCCAAGAAGGAGATGC
  • R:TCTTGTCCTGACCACCAACA
185 60 SYBR
UBI[1] ubiquitin extension protein
  • abiotic Stress
JX177358 '
  • F:TCGACAATGTGAAGGCAAAG
  • R:CTTGATCTTCTTCGGCTTGG
209 60 SYBR
COX[1] cytochrome c oxidase subunit Vc
  • abiotic Stress
S73602.1'
  • F:ACTGGAACAGCCAGAGGAGA
  • R:ATGCAATCTTCCATGGGTTC
159 60 SYBR
GAP[1] glyceraldehyde-3-phosphate dehydrogenase
  • abiotic Stress
  • F:ATACTGTGCACGGACAATGG
  • R:TCAGCCCATGGAATCTCTTC
124 60 SYBR
RPL[1] ribosomal protein L2
  • abiotic Stress
AY596742.1 '
  • F:TTTGACCGAAATGCCCTTAG
  • R:TTCTGGTTCACCCCAACATT
160 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Sung-Chul Park
  • Email: sskwak@kribb.re.kr
  • Institute: Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, Republic of Korea

References

  1. 1.0 1.1 1.2 1.3 1.4 Park S C, Kim Y H, Ji C Y, et al. Stable internal reference genes for the normalization of real-time PCR in different sweetpotato cultivars subjected to abiotic stress conditions[J]. PloS one, 2012, 7(12): e51502.