Difference between revisions of "Ixodes scapularis"

From ICG
Jump to navigation Jump to search
 
(11 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
 
+
[[File:Ixodes scapularis.png|right|200px|link=Ixodes scapularis]]
[[File:Ixodes scapularis-1.jpg|right|327px|]]
+
* '''''Ixodes scapularis''''' are highly efficient arthropod vectors of infectious diseases, being able to transmit viruses, bacteria, protozoa, and helminth parasites. It is a vector for human diseases like Lyme borreliosis, human granulocytic anaplasmosis, and babesiosis in the Central and Eastern United States. It belongs to the subarctic Ixodes persulcatus complex of species that include Ixodes ricinus and Ixodes pacificus, vectors of Lyme disease in Asia, Europe and the western US, respectively<ref name="ref1"/><ref name="ref2"/>.
* Ticks are highly efficient arthropod vectors of infectious diseases, being able to transmit viruses, bacteria, protozoa, and helminth parasites. The tick Ixodes scapularis (= Ixodes dammini) is a vector for such human diseases as Lyme borreliosis, human granulocytic anaplasmosis (= ehrlichiosis), and babesiosis in the Central and Eastern United States. I. scapularis belongs to the subarctic Ixodes persulcatus complex of species that include Ixodes ricinus and Ixodes pacificus, vectors of Lyme disease in Asia, Europe and the western US, respectively.
+
* <font color=blue>'''Common Name:'''</font> '''Deer tick''', '''Blacklegged tick'''
* I. scapularis has three life stages after hatching from the egg: larvae and nymphs feed normally on small rodents, while adults feed on medium to large mammals. After finding a suitable site to feed, hard ticks penetrate the host skin with their mandibles and secrete a glue-like substance that helps to anchor and prevent detachment of the arthropod from the feeding site. Feeding may be accomplished in days or weeks, by the end of which the tick usually has increased in weight by up to 1000 fold its initial size. Feeding is accomplished by sucking blood from a hematoma, or pool of blood, formed in the host skin by mouthpart laceration of the host tissues.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6945 <font color=blue>'''NCBI Taxonomy'''</font>]
* Maintenance of the liquid state of this pool is accomplished by a complex mixture of antihemostatic compounds present in tick saliva. Indeed, ticks alternately feed and salivate in the host skin. Tick saliva also contains antiinflammatory and immunomodulatory compounds that prevent immune reactions from disrupting the feeding process. Probably due to these pharmacologic activities, saliva enhances pathogen transmission, and antisaliva immunity affects pathogen transmission. Accordingly, knowledge of salivary components in vector ticks can lead to the discovery of novel pharmacologic molecules and to the development of novel transmission-blocking vaccine targets against the diseases that ticks transmit<ref name="ref1"/> <ref name="ref2"/>.
 
  
 
=='''''Different Feeding Phases'''''==
 
=='''''Different Feeding Phases'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 20: Line 19:
 
|-
 
|-
 
|align="center"| rps4<ref name="ref1"/>
 
|align="center"| rps4<ref name="ref1"/>
|align="center"| ribosomal protein S4
+
|align="center"| Ribosomal protein S4
 
|
 
|
 
* Salivary glands and synganglia  
 
* Salivary glands and synganglia  
Line 44: Line 43:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 54: Line 54:
 
*'''Institution''':      Department of Entomology, Kansas State University, 123 Waters Hall, Manhattan, KS 66506
 
*'''Institution''':      Department of Entomology, Kansas State University, 123 Waters Hall, Manhattan, KS 66506
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''17''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=15502265173204163279&as_sdt=2005&sciodt=0,5&hl=en '''16'''] (Based on Google Scholar [2017-09-01])
 
 
  
 
=='''References'''==
 
=='''References'''==
Line 66: Line 65:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Animals]] [[Category:mRNA]]
 
[[Category:Animals]] [[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:RPL]] [[Category:RPS]]
 
[[Category:RPL]] [[Category:RPS]]
 
[[Category:Different Feeding Phases]]
 
[[Category:Different Feeding Phases]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 07:25, 1 September 2017

Description

Ixodes scapularis.png
  • Ixodes scapularis are highly efficient arthropod vectors of infectious diseases, being able to transmit viruses, bacteria, protozoa, and helminth parasites. It is a vector for human diseases like Lyme borreliosis, human granulocytic anaplasmosis, and babesiosis in the Central and Eastern United States. It belongs to the subarctic Ixodes persulcatus complex of species that include Ixodes ricinus and Ixodes pacificus, vectors of Lyme disease in Asia, Europe and the western US, respectively[1][2].
  • Common Name: Deer tick, Blacklegged tick
  • NCBI Taxonomy

Different Feeding Phases

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
rps4[1] Ribosomal protein S4
  • Salivary glands and synganglia
DQ066214
  • F:GGTGAAGAAGATTGTCAAGCAGAG
  • R:TGAAGCCAGCAGGGTAGTTTG
80 55 SYBR
l13a[1] Ribosomal protein L13A
  • Salivary glands and synganglia
XM_002436237
  • F:GCATTTCGGGCAGTTTCTTCAG
  • R:TACTTTCGCCTGGGGTTGA
280 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: YOONSEONG PARK
  • Email: ypark@ksu.edu
  • Institution: Department of Entomology, Kansas State University, 123 Waters Hall, Manhattan, KS 66506

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Koči J, Šimo L, Park Y. Validation of internal reference genes for real-time quantitative polymerase chain reaction studies in the tick, Ixodes scapularis (Acari: Ixodidae)[J]. Journal of medical entomology, 2013, 50(1): 79-84.
  2. Kaufman W R. Tick-host interaction: a synthesis of current concepts[J]. Parasitology today, 1989, 5(2): 47-56.

Categories