Difference between revisions of "Jatropha curcas"

From ICG
Jump to navigation Jump to search
Line 86: Line 86:
 
|-
 
|-
 
|align="center"|actin <ref name="ref2"/>
 
|align="center"|actin <ref name="ref2"/>
|align="center"|  
+
|align="center"|actin
 
|
 
|
 
* Different developmental stages  
 
* Different developmental stages  

Revision as of 08:21, 17 October 2017

Description

Jatropha curcas.png
  • Jatropha curcas is a deciduous oil tree species and widely distributed in tropical and subtropical areas, especially in Central and South America, Africa, India and Southeast Asia. As one of the most important energy plants, J. curcas has been considered as a drought-resistant plant and can survive in marginal land. Possibly due to its tropical origin, J. curcas is a chilling sensitive plant and its sensitivity to chilling stress restricts its extensive cultivation and distribution, which further severely inhibits its cultivation and commercialization [1] [2].
  • Common Name: Physic nut
  • NCBI Taxonomy

Staminate & Pistillate Flowers

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TUB[1] Tubulin beta-5 chain
  • Staminate flower
XM_012218098.1
  • F:TTCTGGAATGGGAACTCTGTTGA
  • R:TTGATGTACAGAAAGGGTGGCAT
142 59 ~ 61 SYBR
EF[1] Elongation factor 1-alpha
  • Staminate flower
  • Pistillate flowers
XM_012226913.1
  • F:GTCTGTTGAGATGCACCATGAAG
  • R:TAGAGGCAACAAAACCACGTTTC
108 59 ~ 61 SYBR
GAPDH1[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Pistillate flowers
XM_012231954.1
  • F:TCTGCTGATGCACCAATGTTTG
  • R:ACCTTAGCAAGAGGAGCAAGAC
116 59 ~ 61 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Fang Chen
  • Email: fangchenscu@163.com
  • Institution: Department of Botany, Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, Sichuan University, Chengdu, China

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-09-01])

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
actin [2] actin
  • Different developmental stages
  • Various abiotic stress treatments
  • Vegetative stage
  • Cold stress
Jcr4S06558.10
  • F:5'-CTCCTCTCAACCCCAAAGCCAA-3'
  • R:5'-CACCAGAATCCAGCACGATACCA-3'
147 65 SYBR
GAPDH [2]
  • Different developmental stages
  • Abiotic stress treatments
  • Reproductive stage
  • Cold stress
Jcr4U29393.10
  • F:5'-TGAAGGACTGGAGAGGTGGAAGAGC-3'
  • R:5'-ATCAACAGTTGGAACACGGAAAGCC-3'
140 65 SYBR
EF1α [2]
  • Different developmental stages
  • Reproductive stage
Jcr4S00542.10
  • F:5'-AAGATGATTCCCACCAAGCCCA-3'
  • R:5'-CACAGCAAAACGACCCAGAGGA-3'
72 65 SYBR
TUB5 [2]
  • Desiccation stress
GW878948.1
  • F:5'-TATGTTCCCAGGGCGGTTCTAATG-3'
  • R:5'-GGACTGCCCAAAGACAAAGTTATCG-3'
111 65 SYBR
TUB8 [2]
  • Vegetative stage
  • Desiccation stress
GW877086.1
  • F:5'-GCAGGGAATAACTGGGCTAAAGGT-3'
  • R:5'-CTCCACCCAACGAATGACAAACTT-3'
136 65 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Fang Chen
  • Email: fangchenscu@163.com
  • Institution: Department of Botany, Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, Sichuan University, Chengdu, China

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Karuppaiya P, Yan XX, Liao W, et al. (2017) Identification and validation of superior reference gene for gene expression normalization via RT-qPCR in staminate and pistillate flowers of Jatropha curcas - A biodiesel plant. PLoS One 12, e0172460
  2. 2.0 2.1 2.2 2.3 2.4 2.5 Peng X, Wang Q, Liu H, Shen S (2017) Phylogenetic and functional analysis of the basic transcription factor gene BTF3 from Jatropha curcas. Plant Growth Regulation 82, 247-257

Categories