Difference between revisions of "Jatropha curcas"
Jump to navigation
Jump to search
Wangzhennan (talk | contribs) |
Wangzhennan (talk | contribs) |
||
| Line 72: | Line 72: | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
Cited by [https://scholar.google.com/scholar?cites=10173178948383450853&as_sdt=2005&sciodt=0,5&hl=en '''3'''] (Based on Google Scholar [2017-09-01]) | Cited by [https://scholar.google.com/scholar?cites=10173178948383450853&as_sdt=2005&sciodt=0,5&hl=en '''3'''] (Based on Google Scholar [2017-09-01]) | ||
| + | |||
| + | ==''''''''''== | ||
| + | ===Internal Control Genes=== | ||
| + | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
| + | |- | ||
| + | ! Gene Symbol | ||
| + | ! Gene Name | ||
| + | ! style="width=25% font-size:9pt "|Application Scope | ||
| + | ! Accession Number | ||
| + | ! Primers (5'-3')<br>[Forward/Reverse] | ||
| + | ! Size [bp] | ||
| + | ! Tm [℃] | ||
| + | ! Detection | ||
| + | |- | ||
| + | |align="center"| TUB<ref name="ref1"/> | ||
| + | |align="center"| Tubulin beta-5 chain | ||
| + | | | ||
| + | * Staminate flower | ||
| + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_012218098.1 '''XM_012218098.1'''] | ||
| + | |nowrap style="font-size:9pt"| | ||
| + | * F:TTCTGGAATGGGAACTCTGTTGA | ||
| + | * R:TTGATGTACAGAAAGGGTGGCAT | ||
| + | |align="center"| 142 | ||
| + | |align="center"| 59 ~ 61 | ||
| + | |align="center"| SYBR | ||
| + | |- | ||
| + | |align="center"| EF<ref name="ref1"/> | ||
| + | |align="center"| Elongation factor 1-alpha | ||
| + | | | ||
| + | * Staminate flower | ||
| + | * Pistillate flowers | ||
| + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_012226913.1 '''XM_012226913.1'''] | ||
| + | |nowrap style="font-size:9pt"| | ||
| + | * F:GTCTGTTGAGATGCACCATGAAG | ||
| + | * R:TAGAGGCAACAAAACCACGTTTC | ||
| + | |align="center"| 108 | ||
| + | |align="center"| 59 ~ 61 | ||
| + | |align="center"| SYBR | ||
| + | |- | ||
| + | |align="center"| GAPDH1<ref name="ref1"/> | ||
| + | |align="center"| Glyceraldehyde 3-phosphate dehydrogenase | ||
| + | | | ||
| + | * Pistillate flowers | ||
| + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_012231954.1 '''XM_012231954.1'''] | ||
| + | |nowrap style="font-size:9pt"| | ||
| + | * F:TCTGCTGATGCACCAATGTTTG | ||
| + | * R:ACCTTAGCAAGAGGAGCAAGAC | ||
| + | |align="center"| 116 | ||
| + | |align="center"| 59 ~ 61 | ||
| + | |align="center"| SYBR | ||
| + | |} | ||
| + | |||
| + | ===Molecular Types=== | ||
| + | *mRNA | ||
| + | ===Evaluation Methods=== | ||
| + | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
| + | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
| + | * [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference'''] | ||
| + | * '''Ref-Finder method''' && [https://www.ncbi.nlm.nih.gov/pubmed/22290409 '''Related Reference'''] | ||
| + | * '''Comparative ΔCt method''' && [https://www.ncbi.nlm.nih.gov/pubmed/17026756 '''Related Reference'''] | ||
| + | |||
| + | ===Contact=== | ||
| + | *'''Name''': Fang Chen | ||
| + | *'''Email''': fangchenscu@163.com | ||
| + | *'''Institution''': Department of Botany, Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, Sichuan University, Chengdu, China | ||
| + | |||
| + | ===Citation Statistics=== | ||
| + | Cited by [https://scholar.google.com/scholar?cites=10173178948383450853&as_sdt=2005&sciodt=0,5&hl=en '''3'''] (Based on Google Scholar [2017-09-01]) | ||
| + | |||
=='''References'''== | =='''References'''== | ||
Revision as of 03:12, 17 October 2017
Contents
Description
- Jatropha curcas is a deciduous oil tree species and widely distributed in tropical and subtropical areas, especially in Central and South America, Africa, India and Southeast Asia. As one of the most important energy plants, J. curcas has been considered as a drought-resistant plant and can survive in marginal land. Possibly due to its tropical origin, J. curcas is a chilling sensitive plant and its sensitivity to chilling stress restricts its extensive cultivation and distribution, which further severely inhibits its cultivation and commercialization [1] [2].
- Common Name: Physic nut
- NCBI Taxonomy
Staminate & Pistillate Flowers
Internal Control Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| TUB[1] | Tubulin beta-5 chain |
|
XM_012218098.1 |
|
142 | 59 ~ 61 | SYBR |
| EF[1] | Elongation factor 1-alpha |
|
XM_012226913.1 |
|
108 | 59 ~ 61 | SYBR |
| GAPDH1[1] | Glyceraldehyde 3-phosphate dehydrogenase |
|
XM_012231954.1 |
|
116 | 59 ~ 61 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
- Comparative ΔCt method && Related Reference
Contact
- Name: Fang Chen
- Email: fangchenscu@163.com
- Institution: Department of Botany, Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, Sichuan University, Chengdu, China
Citation Statistics
Cited by 3 (Based on Google Scholar [2017-09-01])
'''''
Internal Control Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| TUB[1] | Tubulin beta-5 chain |
|
XM_012218098.1 |
|
142 | 59 ~ 61 | SYBR |
| EF[1] | Elongation factor 1-alpha |
|
XM_012226913.1 |
|
108 | 59 ~ 61 | SYBR |
| GAPDH1[1] | Glyceraldehyde 3-phosphate dehydrogenase |
|
XM_012231954.1 |
|
116 | 59 ~ 61 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
- Comparative ΔCt method && Related Reference
Contact
- Name: Fang Chen
- Email: fangchenscu@163.com
- Institution: Department of Botany, Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, Sichuan University, Chengdu, China
Citation Statistics
Cited by 3 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Karuppaiya P, Yan XX, Liao W, et al. (2017) Identification and validation of superior reference gene for gene expression normalization via RT-qPCR in staminate and pistillate flowers of Jatropha curcas - A biodiesel plant. PLoS One 12, e0172460
- ↑ Peng X, Wang Q, Liu H, Shen S (2017) Phylogenetic and functional analysis of the basic transcription factor gene BTF3 from Jatropha curcas. Plant Growth Regulation 82, 247-257
