Difference between revisions of "Jatropha curcas"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:Jatropha curcas.png|right|200px|]]
+
[[File:Jatropha curcas.png|right|200px|link=Jatropha curcas]]
 
* '''''Jatropha curcas''''' is a deciduous oil tree species and widely distributed in tropical and subtropical areas, especially in Central and South America, Africa, India and Southeast Asia. As one of the most important energy plants, J. curcas has been considered as a drought-resistant plant and can survive in marginal land. Possibly due to its tropical origin, J. curcas is a chilling sensitive plant and its sensitivity to chilling stress restricts its extensive cultivation and distribution, which further severely inhibits its cultivation and commercialization <ref name="ref1"/> <ref name="ref2"/>.
 
* '''''Jatropha curcas''''' is a deciduous oil tree species and widely distributed in tropical and subtropical areas, especially in Central and South America, Africa, India and Southeast Asia. As one of the most important energy plants, J. curcas has been considered as a drought-resistant plant and can survive in marginal land. Possibly due to its tropical origin, J. curcas is a chilling sensitive plant and its sensitivity to chilling stress restricts its extensive cultivation and distribution, which further severely inhibits its cultivation and commercialization <ref name="ref1"/> <ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Physic nut'''
 
* <font color=blue>'''Common Name:'''</font> '''Physic nut'''

Revision as of 07:25, 29 June 2017

Description

Jatropha curcas.png
  • Jatropha curcas is a deciduous oil tree species and widely distributed in tropical and subtropical areas, especially in Central and South America, Africa, India and Southeast Asia. As one of the most important energy plants, J. curcas has been considered as a drought-resistant plant and can survive in marginal land. Possibly due to its tropical origin, J. curcas is a chilling sensitive plant and its sensitivity to chilling stress restricts its extensive cultivation and distribution, which further severely inhibits its cultivation and commercialization [1] [2].
  • Common Name: Physic nut
  • NCBI Taxonomy

Staminate & Pistillate Flowers

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TUB[1] Tubulin beta-5 chain
  • Staminate flower
XM_012218098.1
  • F:TTCTGGAATGGGAACTCTGTTGA
  • R:TTGATGTACAGAAAGGGTGGCAT
142 59 ~ 61 SYBR
EF[1] Elongation factor 1-alpha
  • Staminate flower
  • Pistillate flowers
XM_012226913.1
  • F:GTCTGTTGAGATGCACCATGAAG
  • R:TAGAGGCAACAAAACCACGTTTC
108 59 ~ 61 SYBR
GAPDH1[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Pistillate flowers
XM_012231954.1
  • F:TCTGCTGATGCACCAATGTTTG
  • R:ACCTTAGCAAGAGGAGCAAGAC
116 59 ~ 61 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Fang Chen
  • Email: fangchenscu@163.com
  • Institution: Department of Botany, Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, Sichuan University, Chengdu, China

Citation Statistics

Cited by 2 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Karuppaiya P, Yan XX, Liao W, et al. (2017) Identification and validation of superior reference gene for gene expression normalization via RT-qPCR in staminate and pistillate flowers of Jatropha curcas - A biodiesel plant. PLoS One 12, e0172460
  2. Peng X, Wang Q, Liu H, Shen S (2017) Phylogenetic and functional analysis of the basic transcription factor gene BTF3 from Jatropha curcas. Plant Growth Regulation 82, 247-257