Jatropha curcas

Description

Jatropha curcas is a deciduous oil tree species and widely distributed in tropical and subtropical areas, especially in Central and South America, Africa, India and Southeast Asia. As one of the most important energy plants, J. curcas has been considered as a drought-resistant plant and can survive in marginal land. Possibly due to its tropical origin, J. curcas is a chilling sensitive plant and its sensitivity to chilling stress restricts its extensive cultivation and distribution, which further severely inhibits its cultivation and commercialization. ^[1] ^[2].
Common Name: Physic nut
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
TUB^[1]	Tubulin beta-5 chain	Staminate flower	XM_012218098.1	F:TTCTGGAATGGGAACTCTGTTGA R:TTCTGGAATGGGAACTCTGTTGA	142	59 ~ 61	SYBR
EF^[1]	Elongation factor 1-alpha	Staminate flower Pistillate flowers	XM_012226913.1	F:GTCTGTTGAGATGCACCATGAAG R:GTCTGTTGAGATGCACCATGAAG	108	59 ~ 61	SYBR
GAPDH1^[1]	Glyceraldehyde 3-phosphate dehydrogenase	Pistillate flowers	XM_012231954.1	F:TCTGCTGATGCACCAATGTTTG R:TCTGCTGATGCACCAATGTTTG	116	59 ~ 61	SYBR

Name: Fang Chen
Email: fangchenscu@163.com
Institution: Department of Botany, Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, Sichuan University, Chengdu, China

Cited by 2 (Based on Google Scholar [2017-06-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Karuppaiya P, Yan XX, Liao W, et al. (2017) Identification and validation of superior reference gene for gene expression normalization via RT-qPCR in staminate and pistillate flowers of Jatropha curcas - A biodiesel plant. PLoS One 12, e0172460
↑ Peng X, Wang Q, Liu H, Shen S (2017) Phylogenetic and functional analysis of the basic transcription factor gene BTF3 from Jatropha curcas. Plant Growth Regulation 82, 247-257