Jatropha curcas

From ICG
Revision as of 09:29, 16 June 2017 by ICG Expert4 (talk | contribs)
Jump to navigation Jump to search

Description

REFqPCR2017005-1.jpg
  • The potential biofuel crop Jatropha curcas has very low tolerance to low temperatures, which is the bottleneck for its cultivation and commercialization.
  • Jatropha curcas is a deciduous oil tree species and widely distributed in tropical and subtropical areas, especially in Central and South America, Africa, India and Southeast Asia. As one of the most important energy plants, J. curcas has been considered as a drought-resistant plant and can survive in marginal land.
  • possibly due to its tropical origin, J. curcas is a chilling sensitive plant and its sensitivity to chilling stress restricts its extensive cultivation and distribution, which further severely inhibits our ability to commercially exploit this plant. [1] [2].

Staminate and Pistillate Flowers

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TUB[1] Tubulin beta-5 chain
  • Staminate flower
XM_012218098.1
  • F:TTCTGGAATGGGAACTCTGTTGA
  • R:TTCTGGAATGGGAACTCTGTTGA
142 59 ~ 61 SYBR
EF[1] Elongation factor 1-alpha
  • Staminate flower
  • Pistillate flowers
XM_012226913.1
  • F:GTCTGTTGAGATGCACCATGAAG
  • R:GTCTGTTGAGATGCACCATGAAG
108 59 ~ 61 SYBR
GAPDH1[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Pistillate flowers
XM_012231954.1
  • F:TCTGCTGATGCACCAATGTTTG
  • R:TCTGCTGATGCACCAATGTTTG
116 59 ~ 61 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Fang Chen
  • Email: fangchenscu@163.com
  • Institution: Department of Botany, Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, Sichuan University, Chengdu, China

Citation Statistics

Cited by 2 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Karuppaiya P, Yan XX, Liao W, et al. (2017) Identification and validation of superior reference gene for gene expression normalization via RT-qPCR in staminate and pistillate flowers of Jatropha curcas - A biodiesel plant. PLoS One 12, e0172460
  2. Peng X, Wang Q, Liu H, Shen S (2017) Phylogenetic and functional analysis of the basic transcription factor gene BTF3 from Jatropha curcas. Plant Growth Regulation 82, 247-257