Difference between revisions of "Lactuca sativa"

From ICG
Jump to navigation Jump to search
Line 77: Line 77:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
[[Category:Plants]]

Revision as of 09:33, 16 June 2017

Description

REFqPCR2017008-1.png
  • Lettuce (Lactuca sativa) is a leafy vegetable cultivated throughout the course of the year, it is harvested when plants reach maturity but before they bolt and flower. In order to avoid harvest loss and wastage it is therefore important to be able to predict and anticipate when the crop will start bolting. Understanding changes in gene expression profiles, in particular those of flowering time genes, throughout development will help to develop predictable cropping.
  • Romaine lettuce, a year or two of herbs, lettuce, asparagus, and chijin. Lettuce is native to the Mediterranean coast, northern Asia, Africa and other countries. Lettuce can be divided into leaf lettuce and stems, lettuce is also called lettuce, leaves from the root minister, and some form a ball, which is called romaine lettuce. The glass lettuce and green lettuce in Guangzhou are excellent varieties. The stems are developed from the roots of lettuce, and in addition to green and purple, the leaves are purple with purple or full purple.
  • Lactuca sativa L. (lettuce) model can be highlighted. Historically, this species has served as model in studies of allelopathic effects owing to its rapid germination, uniformity and sensitivity.[1] [2].

Diurnal & Developmental Time‐course

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
LsPP2A-1[1] PROTEIN PHOSPHATASE 2A-1
  • Diurnal and developmental timecourse experiments
NA
  • F:ATTCATGGTCAATTCTACGATCTGGT
  • R:ATTCATGGTCAATTCTACGATCTGGT
107 60 SYBR
LsPP2AA3[1] PROTEIN PHOSPHATASE 2A REGULATORY SUBUNIT A3
  • Diurnal and developmental timecourse experiments
NA
  • F:CATGCAATGGTTACAAGACAAGGTAT
  • R:CATGCAATGGTTACAAGACAAGGTAT
80 60 SYBR
LsTIP41[1] TAP42-INTERACTING PROTEIN OF 41 kDa
  • Diurnal and developmental timecourse experiments
NA
  • F:TTTGTATGGAGATGAATTGGCTGATA
  • R:TTTGTATGGAGATGAATTGGCTGATA
90 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Stephen Jackson
  • Email: stephen.jackson@warwick.ac.uk
  • Institution: Biology Department, Federal University of Lavras (UFLA), 37.200-000, Lavras, MG, Brazil.

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Sgamma T, Pape J, Massiah A, Jackson S (2016) Selection of reference genes for diurnal and developmental time-course real-time PCR expression analyses in lettuce. Plant Methods 12, 21.
  2. Silveira GL, Lima MGF, Reis GBD, Palmieri MJ, Andrade-Vieria LF (2017) Toxic effects of environmental pollutants: Comparative investigation using Allium cepa L. and Lactuca sativa L. Chemosphere 178, 359-367.