Difference between revisions of "Lactuca sativa"

From ICG
Jump to navigation Jump to search
Line 82: Line 82:
 
|-
 
|-
 
|align="center"| MIR169<ref name="ref1"/>
 
|align="center"| MIR169<ref name="ref1"/>
|align="center"| PROTEIN PHOSPHATASE 2A-1
+
|align="center"| MIR169
 
|
 
|
 
* Leaves
 
* Leaves
Line 89: Line 89:
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:ATTCATGGTCAATTCTACGATCTGGT
+
* F:cagccaaggatgacttgccgg-3
* R:GAATAATACCCGCGATCAACATAATC
+
* R:gtcgtatccagtgcagggtccgaggtattcgcactggatacgacccggct-3
|align="center"| 107
+
|align="center"| 71
|align="center"| 60
+
|align="center"| 84.48
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
 
|align="center"| MIR171/170<ref name="ref1"/>
 
|align="center"| MIR171/170<ref name="ref1"/>
|align="center"| TAP42-INTERACTING PROTEIN OF 41 kDa
+
|align="center"| MIR171/170
 
|
 
|
 
* Leaves
 
* Leaves
Line 103: Line 103:
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:TTTGTATGGAGATGAATTGGCTGATA
+
* F:tgattgagccgagccaatatc-3
* R:CGTAAGAGAAGAAACCAACAGCTAGG
+
* R:gtcgtatccagtgcagggtccgaggtattcgcactggatacgacgatatt-3
|align="center"|  90
+
|align="center"|  71
|align="center"| 60
+
|align="center"| 82.59
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
 
|align="center"| MIR172<ref name="ref1"/>
 
|align="center"| MIR172<ref name="ref1"/>
|align="center"| TAP42-INTERACTING PROTEIN OF 41 kDa
+
|align="center"| MIR172
 
|
 
|
 
* Leaves
 
* Leaves
Line 117: Line 117:
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:TTTGTATGGAGATGAATTGGCTGATA
+
* F:agaatcttgatgatgctgcat-3
* R:CGTAAGAGAAGAAACCAACAGCTAGG
+
* R:gtcgtatccagtgcagggtccgaggtattcgcactggatacgacatgcag-3
|align="center"| 90
+
|align="center"| 71
|align="center"| 60
+
|align="center"| 81.87
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
 
|align="center"| PAL<ref name="ref1"/>
 
|align="center"| PAL<ref name="ref1"/>
|align="center"| TAP42-INTERACTING PROTEIN OF 41 kDa
+
|align="center"| Phenylalanine ammonia-lyase
 
|
 
|
 
* Leaves
 
* Leaves
 
* Drought, salt, heavy metal, and UV-c irradiation conditions
 
* Drought, salt, heavy metal, and UV-c irradiation conditions
 
* Application of abscisic acid (ABA)
 
* Application of abscisic acid (ABA)
|align="center"| NA
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/aF299330.1 '''AF299330''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:TTTGTATGGAGATGAATTGGCTGATA
+
* F:gagaactaagcaaggcggt-3
* R:CGTAAGAGAAGAAACCAACAGCTAGG
+
* R:cgcttacagtttctcaggtgg-3
|align="center"| 90
+
|align="center"| 200
|align="center"| 60
+
|align="center"| 87.13
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
 
|align="center"| HPPD<ref name="ref1"/>
 
|align="center"| HPPD<ref name="ref1"/>
|align="center"| TAP42-INTERACTING PROTEIN OF 41 kDa
+
|align="center"| 4-Hydroxyphenylpyruvate dioxygenase
 
|
 
|
 
* Leaves
 
* Leaves
 
* Drought, salt, heavy metal, and UV-c irradiation conditions
 
* Drought, salt, heavy metal, and UV-c irradiation conditions
 
* Application of abscisic acid (ABA)
 
* Application of abscisic acid (ABA)
|align="center"| NA
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/FJ194493.1 '''FJ194493''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:TTTGTATGGAGATGAATTGGCTGATA
+
* F:ccggcgccttcgttgtgttccagatac-3
* R:CGTAAGAGAAGAAACCAACAGCTAGG
+
* R:gcccgggtttgaaccagttgaaaag-3
|align="center"| 90
+
|align="center"| 309
|align="center"| 60
+
|align="center"| 85.6
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}

Revision as of 08:10, 14 August 2017

Description

Lactuca sativa.png
  • Lactuca sativa is a leafy vegetable cultivated throughout the course of the year. It has served as model in studies of allelopathic effects owing to its rapid germination, uniformity and sensitivity. It is harvested when plants reach maturity but before they bolt and flower. In order to avoid harvest loss and wastage it is therefore important to be able to predict and anticipate when the crop will start bolting. Understanding changes in gene expression profiles, in particular those of flowering time genes, throughout development will help to develop predictable cropping.[1] [2].
  • Common Name: Lettuce
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
LsPP2A-1[1] PROTEIN PHOSPHATASE 2A-1
  • Diurnal and developmental timecourse experiments
NA
  • F:ATTCATGGTCAATTCTACGATCTGGT
  • R:GAATAATACCCGCGATCAACATAATC
107 60 SYBR
LsPP2AA3[1] PROTEIN PHOSPHATASE 2A REGULATORY SUBUNIT A3
  • Diurnal and developmental timecourse experiments
NA
  • F:CATGCAATGGTTACAAGACAAGGTAT
  • R:CAAACTCCTCCGCAAGTCTCTTC
80 60 SYBR
LsTIP41[1] TAP42-INTERACTING PROTEIN OF 41 kDa
  • Diurnal and developmental timecourse experiments
NA
  • F:TTTGTATGGAGATGAATTGGCTGATA
  • R:CGTAAGAGAAGAAACCAACAGCTAGG
90 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Stephen Jackson
  • Email: stephen.jackson@warwick.ac.uk
  • Institution: Biology Department, Federal University of Lavras (UFLA), 37.200-000, Lavras, MG, Brazil.

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-08-10])

Abiotic stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
MIR169[1] MIR169
  • Leaves
  • Drought, salt, heavy metal, and UV-c irradiation conditions
  • Application of abscisic acid (ABA)
NA
  • F:cagccaaggatgacttgccgg-3
  • R:gtcgtatccagtgcagggtccgaggtattcgcactggatacgacccggct-3
71 84.48 SYBR
MIR171/170[1] MIR171/170
  • Leaves
  • Drought, salt, heavy metal, and UV-c irradiation conditions
  • Application of abscisic acid (ABA)
NA
  • F:tgattgagccgagccaatatc-3
  • R:gtcgtatccagtgcagggtccgaggtattcgcactggatacgacgatatt-3
71 82.59 SYBR
MIR172[1] MIR172
  • Leaves
  • Drought, salt, heavy metal, and UV-c irradiation conditions
  • Application of abscisic acid (ABA)
NA
  • F:agaatcttgatgatgctgcat-3
  • R:gtcgtatccagtgcagggtccgaggtattcgcactggatacgacatgcag-3
71 81.87 SYBR
PAL[1] Phenylalanine ammonia-lyase
  • Leaves
  • Drought, salt, heavy metal, and UV-c irradiation conditions
  • Application of abscisic acid (ABA)
AF299330
  • F:gagaactaagcaaggcggt-3
  • R:cgcttacagtttctcaggtgg-3
200 87.13 SYBR
HPPD[1] 4-Hydroxyphenylpyruvate dioxygenase
  • Leaves
  • Drought, salt, heavy metal, and UV-c irradiation conditions
  • Application of abscisic acid (ABA)
FJ194493
  • F:ccggcgccttcgttgtgttccagatac-3
  • R:gcccgggtttgaaccagttgaaaag-3
309 85.6 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Cesar Valmor Rombaldi
  • Email: cesarvrf@ufpel.edu.br
  • Institution: Faculdade de agronomia eliseu Maciel, campus Universitário s/n, Universidade Federal de Pelotas, caixa Postal 354, Pelotas, rS ceP 96010-900, Brazil

Citation Statistics

Cited by 33 (Based on Google Scholar [2017-08-10])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Sgamma T, Pape J, Massiah A, Jackson S (2016) Selection of reference genes for diurnal and developmental time-course real-time PCR expression analyses in lettuce. Plant Methods 12, 21.
  2. Silveira GL, Lima MGF, Reis GBD, Palmieri MJ, Andrade-Vieria LF (2017) Toxic effects of environmental pollutants: Comparative investigation using Allium cepa L. and Lactuca sativa L. Chemosphere 178, 359-367.

Categories