Difference between revisions of "Lactuca sativa"

From ICG
Jump to navigation Jump to search
 
(28 intermediate revisions by 8 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2017008-1.png|right|327px|]]
+
[[File:Lactuca sativa.png|right|200px|link=Lactuca sativa]]
* Lettuce (Lactuca sativa) is a leafy vegetable cultivated throughout the course of the year, it is harvested when plants reach maturity but before they bolt and flower. In order to avoid harvest loss and wastage it is therefore important to be able to predict and anticipate when the crop will start bolting. Understanding changes in gene expression profiles, in particular those of flowering time genes, throughout development will help to develop predictable cropping.
+
* '''''Lactuca sativa''''' is a leafy vegetable cultivated throughout the course of the year. It has served as model in studies of allelopathic effects owing to its rapid germination, uniformity and sensitivity. It is harvested when plants reach maturity but before they bolt and flower. In order to avoid harvest loss and wastage it is therefore important to be able to predict and anticipate when the crop will start bolting. Understanding changes in gene expression profiles, in particular those of flowering time genes, throughout development will help to develop predictable cropping.<ref name="ref1"/> <ref name="ref2"/>.
* Romaine lettuce, a year or two of herbs, lettuce, asparagus, and chijin. Lettuce is native to the Mediterranean coast, northern Asia, Africa and other countries. Lettuce can be divided into leaf lettuce and stems, lettuce is also called lettuce, leaves from the root minister, and some form a ball, which is called romaine lettuce. The glass lettuce and green lettuce in Guangzhou are excellent varieties. The stems are developed from the roots of lettuce, and in addition to green and purple, the leaves are purple with purple or full purple.
+
* <font color=blue>'''Common Name:'''</font> '''Lettuce'''
* Lactuca sativa L. (lettuce) model can be highlighted. Historically, this species has served as model in studies of allelopathic effects owing to its rapid germination, uniformity and sensitivity.<ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4236 <font color=blue>'''NCBI Taxonomy'''</font>]
  
=='''''Diurnal & Developmental Time‐course'''''==
+
=='''''Different Developmental Stages'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 25: Line 25:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ATTCATGGTCAATTCTACGATCTGGT
 
* F:ATTCATGGTCAATTCTACGATCTGGT
* R:ATTCATGGTCAATTCTACGATCTGGT
+
* R:GAATAATACCCGCGATCAACATAATC
 
|align="center"|  107  
 
|align="center"|  107  
 
|align="center"| 60
 
|align="center"| 60
Line 37: Line 37:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CATGCAATGGTTACAAGACAAGGTAT
 
* F:CATGCAATGGTTACAAGACAAGGTAT
* R:CATGCAATGGTTACAAGACAAGGTAT
+
* R:CAAACTCCTCCGCAAGTCTCTTC
 
|align="center"|  80  
 
|align="center"|  80  
 
|align="center"| 60
 
|align="center"| 60
Line 49: Line 49:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TTTGTATGGAGATGAATTGGCTGATA
 
* F:TTTGTATGGAGATGAATTGGCTGATA
* R:TTTGTATGGAGATGAATTGGCTGATA
+
* R:CGTAAGAGAAGAAACCAACAGCTAGG
 
|align="center"|  90  
 
|align="center"|  90  
 
|align="center"| 60
 
|align="center"| 60
Line 55: Line 55:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 65: Line 65:
 
*'''Institution''':  Biology Department, Federal University of Lavras (UFLA), 37.200-000, Lavras, MG, Brazil.
 
*'''Institution''':  Biology Department, Federal University of Lavras (UFLA), 37.200-000, Lavras, MG, Brazil.
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''4''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=4995289360283468869&as_sdt=2005&sciodt=0,5&hl=en'''8'''] (Based on Google Scholar [2017-09-01])
 +
 
 +
=='''''Abiotic stresses'''''==
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25% font-size:9pt "|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| MIR169<ref name="ref3"/>
 +
|align="center"| MIR169
 +
|
 +
* Leaves
 +
* Drought, salt, heavy metal, and UV-c irradiation conditions
 +
* Application of abscisic acid (ABA)
 +
|align="center"| NA
 +
|nowrap style="font-size:9pt"|
 +
* F:CAGCCAAGGATGACTTGCCGG
 +
* R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGGCT
 +
|align="center"| 71
 +
|align="center"| 84.48
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| MIR171/170<ref name="ref3"/>
 +
|align="center"| MIR171/170
 +
|
 +
* Leaves
 +
* Drought, salt, heavy metal, and UV-c irradiation conditions
 +
* Application of abscisic acid (ABA)
 +
|align="center"| NA
 +
|nowrap style="font-size:9pt"|
 +
* F:TGATTGAGCCGAGCCAATATC
 +
* R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGATATT
 +
|align="center"|  71
 +
|align="center"| 82.59
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| MIR172<ref name="ref3"/>
 +
|align="center"| MIR172
 +
|
 +
* Leaves
 +
* Drought, salt, heavy metal, and UV-c irradiation conditions
 +
* Application of abscisic acid (ABA)
 +
|align="center"| NA
 +
|nowrap style="font-size:9pt"|
 +
* F:AGAATCTTGATGATGCTGCAT
 +
* R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGCAG
 +
|align="center"| 71
 +
|align="center"| 81.87
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| PAL<ref name="ref3"/>
 +
|align="center"| Phenylalanine ammonia-lyase
 +
|
 +
* Leaves
 +
* Drought, salt, heavy metal, and UV-c irradiation conditions
 +
* Application of abscisic acid (ABA)
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/aF299330.1 '''AF299330''']
 +
|nowrap style="font-size:9pt"|
 +
* F:GAGAACTAAGCAAGGCGGT
 +
* R:CGCTTACAGTTTCTCAGGTGG
 +
|align="center"| 200
 +
|align="center"| 87.13
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| HPPD<ref name="ref3"/>
 +
|align="center"| 4-Hydroxyphenylpyruvate dioxygenase
 +
|
 +
* Leaves
 +
* Drought, salt, heavy metal, and UV-c irradiation conditions
 +
* Application of abscisic acid (ABA)
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/FJ194493.1 '''FJ194493''']
 +
|nowrap style="font-size:9pt"|
 +
* F:CCGGCGCCTTCGTTGTGTTCCAGATAC
 +
* R:GCCCGGGTTTGAACCAGTTGAAAAG
 +
|align="center"| 309
 +
|align="center"| 85.6
 +
|align="center"| SYBR
 +
|}
 +
 
 +
===Molecular Types===
 +
*mRNA
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
 
 +
===Contact===
 +
*'''Name''': Cesar Valmor Rombaldi
 +
*'''Email''': cesarvrf@ufpel.edu.br
 +
*'''Institution''':  Faculdade de agronomia eliseu Maciel, campus Universitário s/n, Universidade Federal de Pelotas, caixa Postal 354, Pelotas, rS ceP 96010-900, Brazil
 +
 
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=14689297466987950705&as_sdt=2005&sciodt=0,5&hl=en'''33'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 75: Line 173:
 
<ref name="ref2">
 
<ref name="ref2">
 
Silveira GL, Lima MGF, Reis GBD, Palmieri MJ, Andrade-Vieria LF (2017) Toxic effects of environmental pollutants: Comparative investigation using Allium cepa L. and Lactuca sativa L. Chemosphere 178, 359-367.
 
Silveira GL, Lima MGF, Reis GBD, Palmieri MJ, Andrade-Vieria LF (2017) Toxic effects of environmental pollutants: Comparative investigation using Allium cepa L. and Lactuca sativa L. Chemosphere 178, 359-367.
 +
</ref>
 +
<ref name="ref3">
 +
Borowski, Joyce Moura, et al. Selection of candidate reference genes for real-time PCR studies in lettuce under abiotic stresses. Planta 239.6 (2014): 1187-1200.
 
</ref>
 
</ref>
 
</references>
 
</references>
  
[[Category:Plants]]
+
=='''Categories'''==
[[Category:mRNA]] 
+
[[Category:Plants]][[Category:mRNA]][[Category:Non-coding RNA]][[Category:Non-coding RNA]][[Category:SYBR]][[Category:PP2A]] [[Category:PP2A]] [[Category:TIP41]][[Category:PAL]][[Category:HPPD]][[Category:Different Developmental Stages]] [[Category:geNorm]][[Category:NormFinder]]
[[Category:SYBR]]
 

Latest revision as of 07:03, 1 September 2017

Description

Lactuca sativa.png
  • Lactuca sativa is a leafy vegetable cultivated throughout the course of the year. It has served as model in studies of allelopathic effects owing to its rapid germination, uniformity and sensitivity. It is harvested when plants reach maturity but before they bolt and flower. In order to avoid harvest loss and wastage it is therefore important to be able to predict and anticipate when the crop will start bolting. Understanding changes in gene expression profiles, in particular those of flowering time genes, throughout development will help to develop predictable cropping.[1] [2].
  • Common Name: Lettuce
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
LsPP2A-1[1] PROTEIN PHOSPHATASE 2A-1
  • Diurnal and developmental timecourse experiments
NA
  • F:ATTCATGGTCAATTCTACGATCTGGT
  • R:GAATAATACCCGCGATCAACATAATC
107 60 SYBR
LsPP2AA3[1] PROTEIN PHOSPHATASE 2A REGULATORY SUBUNIT A3
  • Diurnal and developmental timecourse experiments
NA
  • F:CATGCAATGGTTACAAGACAAGGTAT
  • R:CAAACTCCTCCGCAAGTCTCTTC
80 60 SYBR
LsTIP41[1] TAP42-INTERACTING PROTEIN OF 41 kDa
  • Diurnal and developmental timecourse experiments
NA
  • F:TTTGTATGGAGATGAATTGGCTGATA
  • R:CGTAAGAGAAGAAACCAACAGCTAGG
90 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Stephen Jackson
  • Email: stephen.jackson@warwick.ac.uk
  • Institution: Biology Department, Federal University of Lavras (UFLA), 37.200-000, Lavras, MG, Brazil.

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])

Abiotic stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
MIR169[3] MIR169
  • Leaves
  • Drought, salt, heavy metal, and UV-c irradiation conditions
  • Application of abscisic acid (ABA)
NA
  • F:CAGCCAAGGATGACTTGCCGG
  • R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGGCT
71 84.48 SYBR
MIR171/170[3] MIR171/170
  • Leaves
  • Drought, salt, heavy metal, and UV-c irradiation conditions
  • Application of abscisic acid (ABA)
NA
  • F:TGATTGAGCCGAGCCAATATC
  • R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGATATT
71 82.59 SYBR
MIR172[3] MIR172
  • Leaves
  • Drought, salt, heavy metal, and UV-c irradiation conditions
  • Application of abscisic acid (ABA)
NA
  • F:AGAATCTTGATGATGCTGCAT
  • R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGCAG
71 81.87 SYBR
PAL[3] Phenylalanine ammonia-lyase
  • Leaves
  • Drought, salt, heavy metal, and UV-c irradiation conditions
  • Application of abscisic acid (ABA)
AF299330
  • F:GAGAACTAAGCAAGGCGGT
  • R:CGCTTACAGTTTCTCAGGTGG
200 87.13 SYBR
HPPD[3] 4-Hydroxyphenylpyruvate dioxygenase
  • Leaves
  • Drought, salt, heavy metal, and UV-c irradiation conditions
  • Application of abscisic acid (ABA)
FJ194493
  • F:CCGGCGCCTTCGTTGTGTTCCAGATAC
  • R:GCCCGGGTTTGAACCAGTTGAAAAG
309 85.6 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Cesar Valmor Rombaldi
  • Email: cesarvrf@ufpel.edu.br
  • Institution: Faculdade de agronomia eliseu Maciel, campus Universitário s/n, Universidade Federal de Pelotas, caixa Postal 354, Pelotas, rS ceP 96010-900, Brazil

Citation Statistics

Cited by 33 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Sgamma T, Pape J, Massiah A, Jackson S (2016) Selection of reference genes for diurnal and developmental time-course real-time PCR expression analyses in lettuce. Plant Methods 12, 21.
  2. Silveira GL, Lima MGF, Reis GBD, Palmieri MJ, Andrade-Vieria LF (2017) Toxic effects of environmental pollutants: Comparative investigation using Allium cepa L. and Lactuca sativa L. Chemosphere 178, 359-367.
  3. 3.0 3.1 3.2 3.3 3.4 Borowski, Joyce Moura, et al. Selection of candidate reference genes for real-time PCR studies in lettuce under abiotic stresses. Planta 239.6 (2014): 1187-1200.

Categories