Difference between revisions of "Lactuca sativa"
Jump to navigation
Jump to search
Yang Zhang (talk | contribs) |
|||
(17 intermediate revisions by 5 users not shown) | |||
Line 6: | Line 6: | ||
=='''''Different Developmental Stages'''''== | =='''''Different Developmental Stages'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 66: | Line 66: | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by '''4''' (Based on Google Scholar [2017- | + | Cited by [https://scholar.google.com/scholar?cites=4995289360283468869&as_sdt=2005&sciodt=0,5&hl=en'''8'''] (Based on Google Scholar [2017-09-01]) |
+ | |||
+ | =='''''Abiotic stresses'''''== | ||
+ | ===Internal Control Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primers (5'-3')<br>[Forward/Reverse] | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| MIR169<ref name="ref3"/> | ||
+ | |align="center"| MIR169 | ||
+ | | | ||
+ | * Leaves | ||
+ | * Drought, salt, heavy metal, and UV-c irradiation conditions | ||
+ | * Application of abscisic acid (ABA) | ||
+ | |align="center"| NA | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CAGCCAAGGATGACTTGCCGG | ||
+ | * R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGGCT | ||
+ | |align="center"| 71 | ||
+ | |align="center"| 84.48 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| MIR171/170<ref name="ref3"/> | ||
+ | |align="center"| MIR171/170 | ||
+ | | | ||
+ | * Leaves | ||
+ | * Drought, salt, heavy metal, and UV-c irradiation conditions | ||
+ | * Application of abscisic acid (ABA) | ||
+ | |align="center"| NA | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TGATTGAGCCGAGCCAATATC | ||
+ | * R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGATATT | ||
+ | |align="center"| 71 | ||
+ | |align="center"| 82.59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| MIR172<ref name="ref3"/> | ||
+ | |align="center"| MIR172 | ||
+ | | | ||
+ | * Leaves | ||
+ | * Drought, salt, heavy metal, and UV-c irradiation conditions | ||
+ | * Application of abscisic acid (ABA) | ||
+ | |align="center"| NA | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:AGAATCTTGATGATGCTGCAT | ||
+ | * R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGCAG | ||
+ | |align="center"| 71 | ||
+ | |align="center"| 81.87 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| PAL<ref name="ref3"/> | ||
+ | |align="center"| Phenylalanine ammonia-lyase | ||
+ | | | ||
+ | * Leaves | ||
+ | * Drought, salt, heavy metal, and UV-c irradiation conditions | ||
+ | * Application of abscisic acid (ABA) | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/aF299330.1 '''AF299330'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GAGAACTAAGCAAGGCGGT | ||
+ | * R:CGCTTACAGTTTCTCAGGTGG | ||
+ | |align="center"| 200 | ||
+ | |align="center"| 87.13 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| HPPD<ref name="ref3"/> | ||
+ | |align="center"| 4-Hydroxyphenylpyruvate dioxygenase | ||
+ | | | ||
+ | * Leaves | ||
+ | * Drought, salt, heavy metal, and UV-c irradiation conditions | ||
+ | * Application of abscisic acid (ABA) | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/FJ194493.1 '''FJ194493'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CCGGCGCCTTCGTTGTGTTCCAGATAC | ||
+ | * R:GCCCGGGTTTGAACCAGTTGAAAAG | ||
+ | |align="center"| 309 | ||
+ | |align="center"| 85.6 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | |||
+ | ===Molecular Types=== | ||
+ | *mRNA | ||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | |||
+ | ===Contact=== | ||
+ | *'''Name''': Cesar Valmor Rombaldi | ||
+ | *'''Email''': cesarvrf@ufpel.edu.br | ||
+ | *'''Institution''': Faculdade de agronomia eliseu Maciel, campus Universitário s/n, Universidade Federal de Pelotas, caixa Postal 354, Pelotas, rS ceP 96010-900, Brazil | ||
+ | |||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=14689297466987950705&as_sdt=2005&sciodt=0,5&hl=en'''33'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 75: | Line 173: | ||
<ref name="ref2"> | <ref name="ref2"> | ||
Silveira GL, Lima MGF, Reis GBD, Palmieri MJ, Andrade-Vieria LF (2017) Toxic effects of environmental pollutants: Comparative investigation using Allium cepa L. and Lactuca sativa L. Chemosphere 178, 359-367. | Silveira GL, Lima MGF, Reis GBD, Palmieri MJ, Andrade-Vieria LF (2017) Toxic effects of environmental pollutants: Comparative investigation using Allium cepa L. and Lactuca sativa L. Chemosphere 178, 359-367. | ||
+ | </ref> | ||
+ | <ref name="ref3"> | ||
+ | Borowski, Joyce Moura, et al. Selection of candidate reference genes for real-time PCR studies in lettuce under abiotic stresses. Planta 239.6 (2014): 1187-1200. | ||
</ref> | </ref> | ||
</references> | </references> | ||
− | [[Category:Plants]] | + | =='''Categories'''== |
− | [[Category:mRNA]] | + | [[Category:Plants]][[Category:mRNA]][[Category:Non-coding RNA]][[Category:Non-coding RNA]][[Category:SYBR]][[Category:PP2A]] [[Category:PP2A]] [[Category:TIP41]][[Category:PAL]][[Category:HPPD]][[Category:Different Developmental Stages]] [[Category:geNorm]][[Category:NormFinder]] |
− | [[Category:SYBR]] | ||
− | [[Category:PP2A]] [[Category:PP2A]] [[Category:TIP41]] | ||
− | [[Category:Different Developmental Stages]] | ||
− | |||
− | [[Category:geNorm]] |
Latest revision as of 07:03, 1 September 2017
Contents
Description
- Lactuca sativa is a leafy vegetable cultivated throughout the course of the year. It has served as model in studies of allelopathic effects owing to its rapid germination, uniformity and sensitivity. It is harvested when plants reach maturity but before they bolt and flower. In order to avoid harvest loss and wastage it is therefore important to be able to predict and anticipate when the crop will start bolting. Understanding changes in gene expression profiles, in particular those of flowering time genes, throughout development will help to develop predictable cropping.[1] [2].
- Common Name: Lettuce
- NCBI Taxonomy
Different Developmental Stages
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
LsPP2A-1[1] | PROTEIN PHOSPHATASE 2A-1 |
|
NA |
|
107 | 60 | SYBR |
LsPP2AA3[1] | PROTEIN PHOSPHATASE 2A REGULATORY SUBUNIT A3 |
|
NA |
|
80 | 60 | SYBR |
LsTIP41[1] | TAP42-INTERACTING PROTEIN OF 41 kDa |
|
NA |
|
90 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Stephen Jackson
- Email: stephen.jackson@warwick.ac.uk
- Institution: Biology Department, Federal University of Lavras (UFLA), 37.200-000, Lavras, MG, Brazil.
Citation Statistics
Cited by 8 (Based on Google Scholar [2017-09-01])
Abiotic stresses
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
MIR169[3] | MIR169 |
|
NA |
|
71 | 84.48 | SYBR |
MIR171/170[3] | MIR171/170 |
|
NA |
|
71 | 82.59 | SYBR |
MIR172[3] | MIR172 |
|
NA |
|
71 | 81.87 | SYBR |
PAL[3] | Phenylalanine ammonia-lyase |
|
AF299330 |
|
200 | 87.13 | SYBR |
HPPD[3] | 4-Hydroxyphenylpyruvate dioxygenase |
|
FJ194493 |
|
309 | 85.6 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Cesar Valmor Rombaldi
- Email: cesarvrf@ufpel.edu.br
- Institution: Faculdade de agronomia eliseu Maciel, campus Universitário s/n, Universidade Federal de Pelotas, caixa Postal 354, Pelotas, rS ceP 96010-900, Brazil
Citation Statistics
Cited by 33 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 Sgamma T, Pape J, Massiah A, Jackson S (2016) Selection of reference genes for diurnal and developmental time-course real-time PCR expression analyses in lettuce. Plant Methods 12, 21.
- ↑ Silveira GL, Lima MGF, Reis GBD, Palmieri MJ, Andrade-Vieria LF (2017) Toxic effects of environmental pollutants: Comparative investigation using Allium cepa L. and Lactuca sativa L. Chemosphere 178, 359-367.
- ↑ 3.0 3.1 3.2 3.3 3.4 Borowski, Joyce Moura, et al. Selection of candidate reference genes for real-time PCR studies in lettuce under abiotic stresses. Planta 239.6 (2014): 1187-1200.