Difference between revisions of "Leptinotarsa decemlineata"

From ICG
Jump to navigation Jump to search
Line 92: Line 92:
 
</references>
 
</references>
 
[[Category:Animals]]
 
[[Category:Animals]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 03:28, 19 June 2017

Description

REFqPCRLeptinotarsa decemlineata.jpg
  • The Colorado potato beetle, Leptinotarsa decemlineata (Say), is an exotic invasive insect pest.
  • It invaded in Xinjiang Uygur autonomous region in China in the 1990s from Kazakhstan. It is a notorious defoliator of potato throughout most of the northern Xinjiang in current, and often causes extremely large yield losses of potato.
  • L. decemlineata has a complicated and diverse life cycle. Moreover, the beetle has developed resistance to many classes of insecticides, among them are organophosphates, carbamates, pyrethroids and neonicotinoids.

Different developmental stages & Tissues & Insecticide Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RP18[1][2] ribosomal protein 18
  • Different developing stages
KC190034
  • F:ACTTCGTGTCACTGAAACTGC
  • R:TATCCGCACGACTTCCTGC
252 60 SYBR
RP4[1] ribosomal protein 4
  • Different developing stages
KC190033
  • F:GCACCAGGTCTTGTTCGTG
  • R:GGGGAATACGGGCGACAG
311 60 SYBR
ARF1[1] ADP-ribosylation factor 1
  • Different developing stages
KC190026
  • F:GGGGAGGCAAACCGGTCA
  • R:GGCTTCTAAACCTAGTGCCTGG
603 60 SYBR
ARF4[1] ADP-ribosylation factor 4
  • Different developing stages
KC190027
  • F:GGACCTATCTTCAGCTATGCGT
  • R:CAATCCCTCGTGAAGGCCA
681 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Guo-Qing Li
  • Email: : liguoqing001234@yahoo.com.cn
  • Institute: Education Ministry Key Laboratory of Integrated Management of Crop Diseases and Pests, College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China

Citation Statistics

Cited by 57 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Shi X Q, Guo W C, Wan P J, et al. Validation of reference genes for expression analysis by quantitative real-time PCR in Leptinotarsa decemlineata (Say)[J]. BMC Research Notes, 2013, 6(1): 93.
  2. Xiao-Qin Shi, Wen-Chao Guo, Pin-Jun Wan, Li-Tao Zhou, Xiang-Liang Ren, Tursun Ahmat, Kai-Yun Fu, and Guo-Qing Li. Validation of reference genes for expression analysis by quantitative real-time PCR in Leptinotarsa decemlineata (Say). BMC Res Notes. 2013; 6: 93. BMC Res Notes. 2013; 6: 93. Published online 2013 Mar 13. doi: 10.1186/1756-0500-6-93. PMCID: PMC3600673.