Difference between revisions of "Leptinotarsa decemlineata"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''Different developmental stages & Tissues & Insecticide Treatments'''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; wid...")
 
Line 4: Line 4:
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
! Gene symbol  
+
! Gene Symbol  
! Gene name
+
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
Line 62: Line 62:
 
|}
 
|}
  
===Moleculer types===
+
===Moleculer Types===
 
* mRNA
 
* mRNA
  
Line 74: Line 74:
 
*'''Email''': : liguoqing001234@yahoo.com.cn
 
*'''Email''': : liguoqing001234@yahoo.com.cn
 
*'''Institute''':  Education Ministry Key Laboratory of Integrated Management of Crop Diseases and Pests, College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China
 
*'''Institute''':  Education Ministry Key Laboratory of Integrated Management of Crop Diseases and Pests, College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China
 +
===Citation Statistics===
 +
Cited by '''57''' (Based on Google Scholar [2017-06-16])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 10:22, 16 June 2017

Description

Different developmental stages & Tissues & Insecticide Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RP18[1] ribosomal protein 18
  • different developing stages
KC190034
  • F:ACTTCGTGTCACTGAAACTGC
  • R:TATCCGCACGACTTCCTGC
252 60 SYBR
RP4[1] ribosomal protein 4
  • different developing stages
KC190033
  • F:GCACCAGGTCTTGTTCGTG
  • R:GGGGAATACGGGCGACAG
311 60 SYBR
ARF1[1] ADP-ribosylation factor 1
  • different developing stages
KC190026
  • F:GGGGAGGCAAACCGGTCA
  • R:GGCTTCTAAACCTAGTGCCTGG
603 60 SYBR
ARF4[1] ADP-ribosylation factor 4
  • different developing stages
KC190027
  • F:GGACCTATCTTCAGCTATGCGT
  • R:CAATCCCTCGTGAAGGCCA
681 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Guo-Qing Li
  • Email: : liguoqing001234@yahoo.com.cn
  • Institute: Education Ministry Key Laboratory of Integrated Management of Crop Diseases and Pests, College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China

Citation Statistics

Cited by 57 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Shi X Q, Guo W C, Wan P J, et al. Validation of reference genes for expression analysis by quantitative real-time PCR in Leptinotarsa decemlineata (Say)[J]. BMC Research Notes, 2013, 6(1): 93.