Difference between revisions of "Leptospira interrogans"

From ICG
Jump to navigation Jump to search
 
(13 intermediate revisions by 5 users not shown)
Line 1: Line 1:
==Description==
+
=='''Description'''==
[[File:REFqPCR200806.jpg|right|227px|]]
+
[[File:Leptospira interrogans.png|right|200px|link=Leptospira interrogans]]
* Leptospires are spirochete bacteria classified into nonpathogenic, intermediate, or pathogenic species and inhabit soil and freshwater reservoirs, predominately in tropical regions (1). Infection with pathogenic Leptospira spp. can result in a large range of clinical manifestations, including fever, renal failure, jaundice, hemorrhage, meningitis, and death. Leptospirosis, the severe manifestation of disease, has an annual global incidence of over 1 million human cases and a case fatality rate of from 5% to 20%.<ref name="ref1"/> <ref name="ref2"/>.
+
* '''''Leptospira interrogans''''' are spirochete bacteria classified into nonpathogenic, intermediate, or pathogenic species and inhabit soil and freshwater reservoirs, predominately in tropical regions. Infection with pathogenic Leptospira spp. can result in a large range of clinical manifestations, including fever, renal failure, jaundice, hemorrhage, meningitis, and death. As the severe manifestation of disease, it has an annual global incidence of over 1 million human cases and a case fatality rate of from 5% to 20%<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''NA'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=173 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Tissues & Abiotic Stress'''''==
 
=='''''Different Tissues & Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 21: Line 23:
 
* Skeletal muscle tissue  
 
* Skeletal muscle tissue  
 
* Temperature Treatment
 
* Temperature Treatment
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/BC108110.1 '''BC108110.1''']
+
|align="center"| NA
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCAGCCATTGTGGAGATG
 
* F:GCAGCCATTGTGGAGATG
Line 34: Line 36:
 
* Skeletal muscle tissue  
 
* Skeletal muscle tissue  
 
* Temperature Treatment
 
* Temperature Treatment
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/BC112573.1 '''BC112573.1''']
+
|align="center"| NA
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CTTTGGAGAGGAATGAAGTGG
 
* F:CTTTGGAGAGGAATGAAGTGG
Line 47: Line 49:
 
* Skeletal muscle tissue  
 
* Skeletal muscle tissue  
 
* Temperature Treatment
 
* Temperature Treatment
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001081510.1 '''NM_001081510.1''']
+
|align="center"| NA
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCGGGAGGAAGAAGTAGGAG
 
* F:GCGGGAGGAAGAAGTAGGAG
Line 70: Line 72:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''33''' (Based on Google Scholar [2017-06-23])
+
Cited by [https://scholar.google.com/scholar?cites=15768779946926232888&as_sdt=2005&sciodt=0,5&hl=en '''32'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 88: Line 90:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Bacteria]]
 
[[Category:Bacteria]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
  
 
[[Category:SYBR]]
 
[[Category:SYBR]]
[[Category:EF1α]] [[Category:HMBS]] [[Category:SF3A1]]
+
[[Category:EF1α]] [[Category:HMBS]] [[Category:SF]]
 
[[Category:Different Tissues]]  [[Category:Abiotic Stress]]  [[Category:Temperature Treatment]]
 
[[Category:Different Tissues]]  [[Category:Abiotic Stress]]  [[Category:Temperature Treatment]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 05:00, 1 September 2017

Description

Leptospira interrogans.png
  • Leptospira interrogans are spirochete bacteria classified into nonpathogenic, intermediate, or pathogenic species and inhabit soil and freshwater reservoirs, predominately in tropical regions. Infection with pathogenic Leptospira spp. can result in a large range of clinical manifestations, including fever, renal failure, jaundice, hemorrhage, meningitis, and death. As the severe manifestation of disease, it has an annual global incidence of over 1 million human cases and a case fatality rate of from 5% to 20%[1][2].
  • Common Name: NA
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1A2[1] Eukaryotic translation elongation factor 1 alpha 2
  • Skeletal muscle tissue
  • Temperature Treatment
NA
  • F:GCAGCCATTGTGGAGATG
  • R:ACTTGCCCGCCTTCTGTG
196 60 SYBR
HMBS[1] Hydroxymethylbilane synthase
  • Skeletal muscle tissue
  • Temperature Treatment
NA
  • F:CTTTGGAGAGGAATGAAGTGG
  • R:AATGGTGAAGCCAGGAGGAA
81 60 SYBR
SF3A1[1] Splicing factor 3 subunit 1
  • Skeletal muscle tissue
  • Temperature Treatment
NA
  • F:GCGGGAGGAAGAAGTAGGAG
  • R:TCAGCAAGAGGGACACAAA
106 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: A. de la Peña-Moctezuma
  • Email: delapema@servidor.unam.mx
  • Institution: Departamento de Microbiologı́a e Inmunologı́a, Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Autónoma de México, Coyoacán 04510, México.

Citation Statistics

Cited by 32 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Carrillo-Casas EM, Hernández-Castro R, Suárez-Güemes F, de la Peña-Moctezuma A. Selection of the internal control gene for real-time quantitative rt-PCR assays in temperature treated Leptospira. Curr Microbiol. 2008 Jun;56(6):539-46. doi: 10.1007/s00284-008-9096-x. Epub 2008 Mar 18. PubMed PMID: 18347854.
  2. Eshghi A, Pappalardo E, Hester S, Thomas B, Pretre G, Picardeau M. Pathogenic Leptospira interrogans exoproteins are primarily involved in heterotrophic processes. Infect Immun. 2015 Aug;83(8):3061-73. doi: 10.1128/IAI.00427-15. Epub 2015 May 18. PubMed PMID: 25987703; PubMed Central PMCID: PMC4496612.

Categories