Difference between revisions of "Leptospira interrogans"

From ICG
Jump to navigation Jump to search
Line 2: Line 2:
 
[[File:REFqPCR200806.jpg|right|227px|]]
 
[[File:REFqPCR200806.jpg|right|227px|]]
 
* Leptospires are spirochete bacteria classified into nonpathogenic, intermediate, or pathogenic species and inhabit soil and freshwater reservoirs, predominately in tropical regions (1). Infection with pathogenic Leptospira spp. can result in a large range of clinical manifestations, including fever, renal failure, jaundice, hemorrhage, meningitis, and death. Leptospirosis, the severe manifestation of disease, has an annual global incidence of over 1 million human cases and a case fatality rate of from 5% to 20%.<ref name="ref1"/> <ref name="ref2"/>.
 
* Leptospires are spirochete bacteria classified into nonpathogenic, intermediate, or pathogenic species and inhabit soil and freshwater reservoirs, predominately in tropical regions (1). Infection with pathogenic Leptospira spp. can result in a large range of clinical manifestations, including fever, renal failure, jaundice, hemorrhage, meningitis, and death. Leptospirosis, the severe manifestation of disease, has an annual global incidence of over 1 million human cases and a case fatality rate of from 5% to 20%.<ref name="ref1"/> <ref name="ref2"/>.
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=173 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Tissues & Abiotic Stress'''''==
 
=='''''Different Tissues & Abiotic Stress'''''==

Revision as of 01:53, 25 June 2017

Description

REFqPCR200806.jpg
  • Leptospires are spirochete bacteria classified into nonpathogenic, intermediate, or pathogenic species and inhabit soil and freshwater reservoirs, predominately in tropical regions (1). Infection with pathogenic Leptospira spp. can result in a large range of clinical manifestations, including fever, renal failure, jaundice, hemorrhage, meningitis, and death. Leptospirosis, the severe manifestation of disease, has an annual global incidence of over 1 million human cases and a case fatality rate of from 5% to 20%.[1] [2].
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1A2[1] Eukaryotic translation elongation factor 1 alpha 2
  • Skeletal muscle tissue
  • Temperature Treatment
BC108110.1
  • F:GCAGCCATTGTGGAGATG
  • R:ACTTGCCCGCCTTCTGTG
196 60 SYBR
HMBS[1] Hydroxymethylbilane synthase
  • Skeletal muscle tissue
  • Temperature Treatment
BC112573.1
  • F:CTTTGGAGAGGAATGAAGTGG
  • R:AATGGTGAAGCCAGGAGGAA
81 60 SYBR
SF3A1[1] Splicing factor 3 subunit 1
  • Skeletal muscle tissue
  • Temperature Treatment
NM_001081510.1
  • F:GCGGGAGGAAGAAGTAGGAG
  • R:TCAGCAAGAGGGACACAAA
106 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: A. de la Peña-Moctezuma
  • Email: delapema@servidor.unam.mx
  • Institution: Departamento de Microbiologı́a e Inmunologı́a, Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Autónoma de México, Coyoacán 04510, México.

Citation Statistics

Cited by 33 (Based on Google Scholar [2017-06-23])

References

  1. 1.0 1.1 1.2 1.3 Carrillo-Casas EM, Hernández-Castro R, Suárez-Güemes F, de la Peña-Moctezuma A. Selection of the internal control gene for real-time quantitative rt-PCR assays in temperature treated Leptospira. Curr Microbiol. 2008 Jun;56(6):539-46. doi: 10.1007/s00284-008-9096-x. Epub 2008 Mar 18. PubMed PMID: 18347854.
  2. Eshghi A, Pappalardo E, Hester S, Thomas B, Pretre G, Picardeau M. Pathogenic Leptospira interrogans exoproteins are primarily involved in heterotrophic processes. Infect Immun. 2015 Aug;83(8):3061-73. doi: 10.1128/IAI.00427-15. Epub 2015 May 18. PubMed PMID: 25987703; PubMed Central PMCID: PMC4496612.