Lilium davidii

Description

• The genus Lilium is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses.
• Lilium davidii var. unicolor, which originates from China, is famous for its economic and ornamental value resulting from its deep red and reflexed petals. It has long been thought of as the best edible lily in China since the scales are jade white and thick, glutinous and sweet, delicate, and without residue.
• Lilies (Lilium spp.), a group of monocotyledonous ornamental plants, are one of the major bulbous flowers in the floriculture industry. Taxonomically, the Lilium genus is comprised of 115 species, about 55 of which originate from PR China [2]. L. davidii var. unicolor, a mutation of L. davidii Duchartre, is an important genus, both economically and ornamentally, in Lanzhou, Gansu province in PR China. .

Different Experimental Conditions

Reference Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
ACT	Actin	Different organs Leaves, scales and roots under stress treatments Leaves and scales at different developmental stages	KP861871	F:ATCTATGAGGGTTATGCTCTTCC R:ATCTATGAGGGTTATGCTCTTCC	241	60	SYBR
GAPDH	Glyceraldehyde-3- phosphate dehydrogenase	Different organs Leaves and scales at different developmental stages	KP179417	F:GCTGCAAGTTTCAACATTATTCC R:GCTGCAAGTTTCAACATTATTCC	240	60	SYBR
UBQ	Ubiquitin	Different organs	KP861873	F:TATGGTGGATTATCGGTTTCTACTG R:TATGGTGGATTATCGGTTTCTACTG	293	60	SYBR
AP4	AP-4 complex subunit	Different organs Leaves, scales and roots under stress treatments Leaves and scales at different developmental stages	KP861878	F:GATGGGGCTTCTTTATACGGT R:GATGGGGCTTCTTTATACGGT	163	60	SYBR
FP	F-box family protein	Leaves, scales and roots under stress treatments	KP861876	F:TCGCCTACATCGCTAACC R:TCGCCTACATCGCTAACC	169	60	SYBR

Moleculer Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference
• BestKeeper method && Related Reference
• ΔCt approach method && Related Reference

Contact

• Name: HongMei Sun
• Email: hmbh@sina.com
• Institution: Key Laboratory of Protected Horticulture of Education Ministry and Liaoning Province, College of Horticulture, Shenyang Agricultural University, Shenyang, P R China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-16])