Difference between revisions of "Lilium davidii"

From ICG
Jump to navigation Jump to search
Line 97: Line 97:
 
*'''Institution''': Key Laboratory of Protected Horticulture of Education Ministry and Liaoning Province, College of Horticulture, Shenyang Agricultural University, Shenyang, P R China
 
*'''Institution''': Key Laboratory of Protected Horticulture of Education Ministry and Liaoning Province, College of Horticulture, Shenyang Agricultural University, Shenyang, P R China
  
==Citation Statistics==
+
===Citation Statistics===
 
Cited by '''6''' (Based on Google Scholar [2017-06-16])
 
Cited by '''6''' (Based on Google Scholar [2017-06-16])
  

Revision as of 07:54, 16 June 2017

Description

REFqPCR2015029-1.jpg
  • The genus Lilium is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses.
  • Lilium davidii var. unicolor, which originates from China, is famous for its economic and ornamental value resulting from its deep red and reflexed petals. It has long been thought of as the best edible lily in China since the scales are jade white and thick, glutinous and sweet, delicate, and without residue.
  • Lilies (Lilium spp.), a group of monocotyledonous ornamental plants, are one of the major bulbous flowers in the floriculture industry. Taxonomically, the Lilium genus is comprised of 115 species, about 55 of which originate from PR China [2]. L. davidii var. unicolor, a mutation of L. davidii Duchartre, is an important genus, both economically and ornamentally, in Lanzhou, Gansu province in PR China. [1] [2].

Different Experimental Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT[1] Actin
  • Different organs
  • Leaves, scales and roots under stress treatments
  • Leaves and scales at different developmental stages
KP861871
  • F:ATCTATGAGGGTTATGCTCTTCC
  • R:ATCTATGAGGGTTATGCTCTTCC
241 60 SYBR
GAPDH[1] Glyceraldehyde-3- phosphate dehydrogenase
  • Different organs
  • Leaves and scales at different developmental stages
KP179417
  • F:GCTGCAAGTTTCAACATTATTCC
  • R:GCTGCAAGTTTCAACATTATTCC
240 60 SYBR
UBQ[1] Ubiquitin
  • Different organs
KP861873
  • F:TATGGTGGATTATCGGTTTCTACTG
  • R:TATGGTGGATTATCGGTTTCTACTG
293 60 SYBR
AP4[1] AP-4 complex subunit
  • Different organs
  • Leaves, scales and roots under stress treatments
  • Leaves and scales at different developmental stages
KP861878
  • F:GATGGGGCTTCTTTATACGGT
  • R:GATGGGGCTTCTTTATACGGT
163 60 SYBR
FP[1] F-box family protein
  • Leaves, scales and roots under stress treatments
KP861876
  • F:TCGCCTACATCGCTAACC
  • R:TCGCCTACATCGCTAACC
169 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: HongMei Sun
  • Email: hmbh@sina.com
  • Institution: Key Laboratory of Protected Horticulture of Education Ministry and Liaoning Province, College of Horticulture, Shenyang Agricultural University, Shenyang, P R China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Li X, Cheng J, Zhang J, et al. (2015) Validation of Reference Genes for Accurate Normalization of Gene Expression in Lilium davidii var. unicolor for Real Time Quantitative PCR. PLoS One 10, e0141323.
  2. Li XY, Wang CX, Cheng JY, et al. (2014) Transcriptome analysis of carbohydrate metabolism during bulblet formation and development in Lilium davidii var. unicolor. Bmc Plant Biology 14.