Difference between revisions of "Lilium davidii"

Revision as of 09:09, 29 June 2017

Lilium davidii var. unicolor, which originates from China, is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses^[1]^[2].

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
ACT^[1]	Actin	Different organs Leaves, scales and roots under stress treatments Leaves and scales at different developmental stages	KP861871	F:ATCTATGAGGGTTATGCTCTTCC R:CATCAGGCAGCTCGTAACTTC	241	60	SYBR
GAPDH^[1]	Glyceraldehyde-3- phosphate dehydrogenase	Different organs Leaves and scales at different developmental stages	KP179417	F:GCTGCAAGTTTCAACATTATTCC R:ATCCTCATCAGTATAACCAAGA	240	60	SYBR
UBQ^[1]	Ubiquitin	Different organs	KP861873	F:TATGGTGGATTATCGGTTTCTACTG R:ACCACAGACTTTTTCAGTATCGCA	293	60	SYBR
AP4^[1]	AP-4 complex subunit	Different organs Leaves, scales and roots under stress treatments Leaves and scales at different developmental stages	KP861878	F:GATGGGGCTTCTTTATACGGT R:TCATTACAGCAAACTCTCCCTCT	163	60	SYBR
FP^[1]	F-box family protein	Leaves, scales and roots under stress treatments	KP861876	F:TCGCCTACATCGCTAACC R:TTCCCAATAATCGCAAGACC	169	60	SYBR

Name: HongMei Sun
Email: hmbh@sina.com
Institution: Key Laboratory of Protected Horticulture of Education Ministry and Liaoning Province, College of Horticulture, Shenyang Agricultural University, Shenyang, P R China

Cited by 6 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 Li X, Cheng J, Zhang J, et al. (2015) Validation of Reference Genes for Accurate Normalization of Gene Expression in Lilium davidii var. unicolor for Real Time Quantitative PCR. PLoS One 10, e0141323.
↑ Li XY, Wang CX, Cheng JY, et al. (2014) Transcriptome analysis of carbohydrate metabolism during bulblet formation and development in Lilium davidii var. unicolor. Bmc Plant Biology 14.

@@ Line 1: / Line 1: @@
 ==Description==
 [[File:Lilium davidii var. davidii.png|right|200px|link=Lilium davidii var. davidii]]
-* '''''Lilium davidii var. unicolor''''', which originates from China, is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses<ref name="ref1"/> <ref name="ref2"/>.
+* '''''Lilium davidii var. unicolor''''', which originates from China, is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses<ref name="ref1"/><ref name="ref2"/>.
 * <font color=blue>'''Common Name:'''</font> '''Lanzhou lily'''