Difference between revisions of "Lilium davidii"

From ICG
Jump to navigation Jump to search
 
(14 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2015029-1.jpg|right|327px|]]
+
[[File:Lilium davidii var. davidii.png|right|200px|link=Lilium davidii var. davidii]]
* The genus Lilium is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses.
+
* '''''Lilium davidii var. unicolor''''', which originates from China, is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses<ref name="ref1"/><ref name="ref2"/>.
* Lilium davidii var. unicolor, which originates from China, is famous for its economic and ornamental value resulting from its deep red and reflexed petals. It has long been thought of as the best edible lily in China since the scales are jade white and thick, glutinous and sweet, delicate, and without residue.
+
 
* Lilies (Lilium spp.), a group of monocotyledonous ornamental plants, are one of the major bulbous flowers in the floriculture industry. Taxonomically, the Lilium genus is comprised of 115 species, about 55 of which originate from PR China [2]. L. davidii var. unicolor, a mutation of L. davidii Duchartre, is an important genus, both economically and ornamentally, in Lanzhou, Gansu province in PR China. <ref name="ref1"/> <ref name="ref2"/>.  
+
* <font color=blue>'''Common Name:'''</font> '''Lanzhou lily'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=859528 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Experimental Conditions'''''==
 
=='''''Different Experimental Conditions'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 27: Line 28:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ATCTATGAGGGTTATGCTCTTCC
 
* F:ATCTATGAGGGTTATGCTCTTCC
* R:ATCTATGAGGGTTATGCTCTTCC
+
* R:CATCAGGCAGCTCGTAACTTC
 
|align="center"|  241  
 
|align="center"|  241  
 
|align="center"| 60
 
|align="center"| 60
Line 40: Line 41:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCTGCAAGTTTCAACATTATTCC
 
* F:GCTGCAAGTTTCAACATTATTCC
* R:GCTGCAAGTTTCAACATTATTCC
+
* R:ATCCTCATCAGTATAACCAAGA
 
|align="center"|  240  
 
|align="center"|  240  
 
|align="center"| 60
 
|align="center"| 60
Line 52: Line 53:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TATGGTGGATTATCGGTTTCTACTG
 
* F:TATGGTGGATTATCGGTTTCTACTG
* R:TATGGTGGATTATCGGTTTCTACTG
+
* R:ACCACAGACTTTTTCAGTATCGCA
 
|align="center"|  293  
 
|align="center"|  293  
 
|align="center"| 60
 
|align="center"| 60
Line 66: Line 67:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GATGGGGCTTCTTTATACGGT
 
* F:GATGGGGCTTCTTTATACGGT
* R:GATGGGGCTTCTTTATACGGT
+
* R:TCATTACAGCAAACTCTCCCTCT
 
|align="center"|  163  
 
|align="center"|  163  
 
|align="center"| 60
 
|align="center"| 60
Line 78: Line 79:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TCGCCTACATCGCTAACC
 
* F:TCGCCTACATCGCTAACC
* R:TCGCCTACATCGCTAACC
+
* R:TTCCCAATAATCGCAAGACC
 
|align="center"|  169  
 
|align="center"|  169  
 
|align="center"| 60
 
|align="center"| 60
Line 84: Line 85:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 98: Line 100:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''6''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=2879818306586129832&as_sdt=2005&sciodt=0,5&hl=en'''6'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 109: Line 111:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Plants]] [[Category:mRNA]]
 
[[Category:Plants]] [[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 +
[[Category:ACT]] [[Category:AP]] [[Category:F-box]] [[Category:GAPDH]] [[Category:Ubiquitin]][[Category:Salinity Treatment]]  [[Category:Different Experimental Conditions]]  [[Category:Abiotic Stress]]  [[Category:Heat Treatment]]  [[Category:Different Tissues]]  [[Category:Cold Treatment]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]

Latest revision as of 07:05, 1 September 2017

Description

Lilium davidii var. davidii.png
  • Lilium davidii var. unicolor, which originates from China, is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses[1][2].

Different Experimental Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT[1] Actin
  • Different organs
  • Leaves, scales and roots under stress treatments
  • Leaves and scales at different developmental stages
KP861871
  • F:ATCTATGAGGGTTATGCTCTTCC
  • R:CATCAGGCAGCTCGTAACTTC
241 60 SYBR
GAPDH[1] Glyceraldehyde-3- phosphate dehydrogenase
  • Different organs
  • Leaves and scales at different developmental stages
KP179417
  • F:GCTGCAAGTTTCAACATTATTCC
  • R:ATCCTCATCAGTATAACCAAGA
240 60 SYBR
UBQ[1] Ubiquitin
  • Different organs
KP861873
  • F:TATGGTGGATTATCGGTTTCTACTG
  • R:ACCACAGACTTTTTCAGTATCGCA
293 60 SYBR
AP4[1] AP-4 complex subunit
  • Different organs
  • Leaves, scales and roots under stress treatments
  • Leaves and scales at different developmental stages
KP861878
  • F:GATGGGGCTTCTTTATACGGT
  • R:TCATTACAGCAAACTCTCCCTCT
163 60 SYBR
FP[1] F-box family protein
  • Leaves, scales and roots under stress treatments
KP861876
  • F:TCGCCTACATCGCTAACC
  • R:TTCCCAATAATCGCAAGACC
169 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: HongMei Sun
  • Email: hmbh@sina.com
  • Institution: Key Laboratory of Protected Horticulture of Education Ministry and Liaoning Province, College of Horticulture, Shenyang Agricultural University, Shenyang, P R China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Li X, Cheng J, Zhang J, et al. (2015) Validation of Reference Genes for Accurate Normalization of Gene Expression in Lilium davidii var. unicolor for Real Time Quantitative PCR. PLoS One 10, e0141323.
  2. Li XY, Wang CX, Cheng JY, et al. (2014) Transcriptome analysis of carbohydrate metabolism during bulblet formation and development in Lilium davidii var. unicolor. Bmc Plant Biology 14.

Categories