Difference between revisions of "Lilium davidii"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
|||
(16 intermediate revisions by 6 users not shown) | |||
Line 1: | Line 1: | ||
==Description== | ==Description== | ||
− | [[File: | + | [[File:Lilium davidii var. davidii.png|right|200px|link=Lilium davidii var. davidii]] |
− | * | + | * '''''Lilium davidii var. unicolor''''', which originates from China, is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses<ref name="ref1"/><ref name="ref2"/>. |
− | + | ||
− | + | * <font color=blue>'''Common Name:'''</font> '''Lanzhou lily''' | |
+ | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=859528 <font color=blue>'''NCBI Taxonomy'''</font>] | ||
=='''''Different Experimental Conditions'''''== | =='''''Different Experimental Conditions'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 13: | Line 14: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 27: | Line 28: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:ATCTATGAGGGTTATGCTCTTCC | * F:ATCTATGAGGGTTATGCTCTTCC | ||
− | * R: | + | * R:CATCAGGCAGCTCGTAACTTC |
|align="center"| 241 | |align="center"| 241 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 40: | Line 41: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GCTGCAAGTTTCAACATTATTCC | * F:GCTGCAAGTTTCAACATTATTCC | ||
− | * R: | + | * R:ATCCTCATCAGTATAACCAAGA |
|align="center"| 240 | |align="center"| 240 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 52: | Line 53: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TATGGTGGATTATCGGTTTCTACTG | * F:TATGGTGGATTATCGGTTTCTACTG | ||
− | * R: | + | * R:ACCACAGACTTTTTCAGTATCGCA |
|align="center"| 293 | |align="center"| 293 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 66: | Line 67: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GATGGGGCTTCTTTATACGGT | * F:GATGGGGCTTCTTTATACGGT | ||
− | * R: | + | * R:TCATTACAGCAAACTCTCCCTCT |
|align="center"| 163 | |align="center"| 163 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 78: | Line 79: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TCGCCTACATCGCTAACC | * F:TCGCCTACATCGCTAACC | ||
− | * R: | + | * R:TTCCCAATAATCGCAAGACC |
|align="center"| 169 | |align="center"| 169 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 84: | Line 85: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
*mRNA | *mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 97: | Line 99: | ||
*'''Institution''': Key Laboratory of Protected Horticulture of Education Ministry and Liaoning Province, College of Horticulture, Shenyang Agricultural University, Shenyang, P R China | *'''Institution''': Key Laboratory of Protected Horticulture of Education Ministry and Liaoning Province, College of Horticulture, Shenyang Agricultural University, Shenyang, P R China | ||
− | ==Citation Statistics== | + | ===Citation Statistics=== |
− | Cited by '''6''' (Based on Google Scholar [2017- | + | Cited by [https://scholar.google.com/scholar?cites=2879818306586129832&as_sdt=2005&sciodt=0,5&hl=en'''6'''] (Based on Google Scholar [2017-09-01]) |
=='''References'''== | =='''References'''== | ||
Line 109: | Line 111: | ||
</ref> | </ref> | ||
</references> | </references> | ||
− | [[Category:Plants]] | + | =='''Categories'''== |
+ | [[Category:Plants]] [[Category:mRNA]] | ||
+ | [[Category:SYBR]] | ||
+ | [[Category:ACT]] [[Category:AP]] [[Category:F-box]] [[Category:GAPDH]] [[Category:Ubiquitin]][[Category:Salinity Treatment]] [[Category:Different Experimental Conditions]] [[Category:Abiotic Stress]] [[Category:Heat Treatment]] [[Category:Different Tissues]] [[Category:Cold Treatment]] | ||
+ | |||
+ | [[Category:geNorm]] | ||
+ | [[Category:NormFinder]] | ||
+ | [[Category:BestKeeper]] | ||
+ | [[Category:Delta Ct]] |
Latest revision as of 07:05, 1 September 2017
Contents
Description
- Lilium davidii var. unicolor, which originates from China, is one of the most valuable commercial market flower bulbs in the world, mainly owing to its ornamental function as a cut flower or as a potted plant. Many Lilium species and cultivars are valued for their magnificent and showy flowers, more or less recurved tepals, distinctive fragrance, wide adaptability to soils and climates, and resistance to biotic stresses[1][2].
- Common Name: Lanzhou lily
- NCBI Taxonomy
Different Experimental Conditions
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
ACT[1] | Actin |
|
KP861871 |
|
241 | 60 | SYBR |
GAPDH[1] | Glyceraldehyde-3- phosphate dehydrogenase |
|
KP179417 |
|
240 | 60 | SYBR |
UBQ[1] | Ubiquitin |
|
KP861873 |
|
293 | 60 | SYBR |
AP4[1] | AP-4 complex subunit |
|
KP861878 |
|
163 | 60 | SYBR |
FP[1] | F-box family protein |
|
KP861876 |
|
169 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: HongMei Sun
- Email: hmbh@sina.com
- Institution: Key Laboratory of Protected Horticulture of Education Ministry and Liaoning Province, College of Horticulture, Shenyang Agricultural University, Shenyang, P R China
Citation Statistics
Cited by 6 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Li X, Cheng J, Zhang J, et al. (2015) Validation of Reference Genes for Accurate Normalization of Gene Expression in Lilium davidii var. unicolor for Real Time Quantitative PCR. PLoS One 10, e0141323.
- ↑ Li XY, Wang CX, Cheng JY, et al. (2014) Transcriptome analysis of carbohydrate metabolism during bulblet formation and development in Lilium davidii var. unicolor. Bmc Plant Biology 14.