Lilium regale

Description

Lilium regale is one of the most important floricultural crops with great ornamental value in the world. Thousands of cultivars in this genus were produced under inter-specific hybridization and artificial selection in the last twenty years. It is a vigorous bulbous perennial to 2m in height, with narrow glossy green leaves and racemes of fragrant, trumpet-shaped white flowers, yellow in the centre and flushed with purple on the outside. There was a positive correlation between volatile emissions and floral scent intensities. The scented and light-scented Lilium species emitted greater amounts of volatiles at night. ^[1] ^[2].
Common Name: Regal lily
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
BHLH^[1]	Basic helix-loop-helix	Different developmental stages & stress	KJ543467	F:CCAGCAGGTTGTCCTTGTG R:TCCGTGATGAGAAGCAGAGG	142	56	SYBR
SAND^[1]	SAND family protein	Under biotic stress Under cold stress	KJ543463	F:CCAATACCCAGATGAGGAGACAAA R:GGATTCGCATTGAGGCTGTTC	178	54	SYBR
CYP^[1]	Cycolphilin A	Under drought stress Heat stress	KJ543464	F:ACCCTTGGGCAAGAACAACAGAA R:GCAAAGGAGGTTGAGTTGGAGGAT	127	56	SYBR
GAPDH^[1]	Glyceraldehyde-3-phosphate dehydrogenase	Different developmental stages & stress Under drought stress Under cold stress	KJ543468	F:CACGGTCAGTGGAAGCACCATGAGAT R:AGCAGCAGCCTTATCCTTGTCAGTGA	180	60	SYBR
TIP41^[1]	TIP41 family protein	Salinity stress	KJ543466	F:CGAAGCCAGAAACGGAGAAGAAT R:GGGTAGGGTGGATTGGGAAGA	192	55	SYBR
EF1^[1]	Elongation factor 1-a	Various developmental stages	KJ543461	F:GGCACTAACTCGCTCCTTCTG R:TTGGTAAGATGCTGGTGATTGGAT	173	55	SYBR

Name: Gui-Xia Jia
Email: gxjia@bjfu.edu.cn
Institution: Beijing Key Laboratory of Ornamental Plants Germplasm Innovation & Molecular Breeding, National Engineering Research Center for Floriculture, Beijing Laboratory of Urban and Rural Ecological Environment and College of Landscape Architecture, Beijing Forestry University, Beijing, China

Cited by 6 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 Liu Q, Wei C, Zhang MF, Jia GX (2016) Evaluation of putative reference genes for quantitative real-time PCR normalization in Lilium regale during development and under stress. PeerJ 4, e1837
↑ Kong Y, Bai JR, Lang LX, et al. (2017) Floral scents produced by Lilium and Cardiocrinum species native to China. Biochemical Systematics and Ecology 70, 222-229.