Difference between revisions of "Litsea cubeba"

From ICG
Jump to navigation Jump to search
 
(11 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
  
[[File:Litsea cubeba-1.jpg|right|327px|]]
+
[[File:Litsea cubeba.png|right|200px|link=Litsea cubeba]]
* Litsea cubeba (Lour.) Persoon, which is indigenous to Eastern Asia, is an evergreen tree or shrub belonging to the Lauraceae family. It is considered as a promising industrial crop due to abundant essential oils extracted from the fruit. The essential oil is a pale yellow liquid with a spicy, intensely lemon-like ?avour. It has been widely used as raw materials in chemical industries and also as fragrance enhancers in foods. Besides, essential oils have had a long history of being used in medical industries<ref name="ref1"/> <ref name="ref2"/>.  
+
* '''''Litsea cubeba''''', indigenous to Eastern Asia, is an evergreen tree or shrub belonging to the Lauraceae family. It is considered as a promising industrial crop due to abundant essential oils extracted from the fruit. The essential oil is a pale yellow liquid with a spicy, intensely lemon-like flavour. It has been widely used as raw materials in chemical industries and also as fragrance enhancers in foods. Besides, essential oils have had a long history of being used in medical industries<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''May chang''', '''Aromatic litsea'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=155299 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Developmental Stages & Tissues'''''==
 
=='''''Different Developmental Stages & Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 20: Line 22:
 
|align="center"| F-box protein
 
|align="center"| F-box protein
 
|
 
|
* Universal reference gene
+
* Different fruit developmental stages
 +
* Leaves, leaf buds, flower, flower buds, and stems
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF706377 '''KF706377''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF706377 '''KF706377''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 32: Line 35:
 
|align="center"| Tubulin alpha
 
|align="center"| Tubulin alpha
 
|
 
|
* Universal reference gene
+
* Different fruit developmental stages
 +
* Leaves, leaf buds, flower, flower buds, and stems
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF706381 '''KF706381''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF706381 '''KF706381''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 44: Line 48:
 
|align="center"| Elongation factor 1-alpha
 
|align="center"| Elongation factor 1-alpha
 
|
 
|
* Universal reference gene
+
* Different fruit developmental stages
 +
* Leaves, leaf buds, flower, flower buds, and stems
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF706375 '''KF706375''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF706375 '''KF706375''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 56: Line 61:
 
|align="center"| Ubiquitin-conjugating enzyme
 
|align="center"| Ubiquitin-conjugating enzyme
 
|
 
|
* Universal reference gene
+
* Different fruit developmental stages
 +
* Leaves, leaf buds, flower, flower buds, and stems
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF706383 '''KF706383''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF706383 '''KF706383''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 68: Line 74:
 
|align="center"| Eukaryotic initiation factor 4-alpha
 
|align="center"| Eukaryotic initiation factor 4-alpha
 
|
 
|
* Universal reference gene
+
* Different fruit developmental stages
 +
* Leaves, leaf buds, flower, flower buds, and stems
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF706376 '''KF706376''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF706376 '''KF706376''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 78: Line 85:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 88: Line 96:
 
*'''Institution''':  State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing 100091, People's Republic of China
 
*'''Institution''':  State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing 100091, People's Republic of China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''14''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=742698539944942718&as_sdt=2005&sciodt=0,5&hl=en'''15'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 99: Line 107:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
+
=='''Categories'''==
[[Category:EF1α]] [[Category:eIF]] [[Category:F-box]] [[Category:Tubulin]] [[Category:Ubiquitin]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]] [[Category:EF1α]][[Category:eIF]][[Category:F-box]][[Category:Tubulin]] [[Category:Ubiquitin]]
[[Category:Different Tissues]] [[Category:Different Developmental Stages]]
+
[[Category:Different Tissues]][[Category:Different Developmental Stages]]
 +
[[Category:geNorm]] [[Category:NormFinder]]

Latest revision as of 07:06, 1 September 2017

Description

Litsea cubeba.png
  • Litsea cubeba, indigenous to Eastern Asia, is an evergreen tree or shrub belonging to the Lauraceae family. It is considered as a promising industrial crop due to abundant essential oils extracted from the fruit. The essential oil is a pale yellow liquid with a spicy, intensely lemon-like flavour. It has been widely used as raw materials in chemical industries and also as fragrance enhancers in foods. Besides, essential oils have had a long history of being used in medical industries[1][2].
  • Common Name: May chang, Aromatic litsea
  • NCBI Taxonomy

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
F-BOX[1] F-box protein
  • Different fruit developmental stages
  • Leaves, leaf buds, flower, flower buds, and stems
KF706377
  • F:CCGAGCAGGATGATGCTAAT
  • R:AAACAGAGGCCCCCTTTAGA
154 60 SYBR
TUA[1] Tubulin alpha
  • Different fruit developmental stages
  • Leaves, leaf buds, flower, flower buds, and stems
KF706381
  • F:GCTGTCCTGCTTGACAATGA
  • R:AAATGGATCCTTGGGTAGGG
200 60 SYBR
EF1α[1] Elongation factor 1-alpha
  • Different fruit developmental stages
  • Leaves, leaf buds, flower, flower buds, and stems
KF706375
  • F:TGGTCGTGTTGAGACTGGAG
  • R:GACAAACCCACGCTTCAGAT
184 60 SYBR
UBC[1] Ubiquitin-conjugating enzyme
  • Different fruit developmental stages
  • Leaves, leaf buds, flower, flower buds, and stems
KF706383
  • F:TGTGTGTGTGTGTGTGTGTCC
  • R:CCTTTCTCCACGGTCTTCAA
121 60 SYBR
EIF4α[1] Eukaryotic initiation factor 4-alpha
  • Different fruit developmental stages
  • Leaves, leaf buds, flower, flower buds, and stems
KF706376
  • F:CGAGGCCCTTGAAATCACT
  • R:GGGTCTCCAACTTCCATTCTT
134 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yangdong Wang
  • Email: wyd11111@126.com
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing 100091, People's Republic of China

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Lin L, Han X, Chen Y, et al. Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba[J]. Molecular genetics and genomics, 2013, 288(12): 727-737.
  2. Luo M, Jiang L, Zou G (2005) Acute and genetic toxicity of essential oil extracted from Litsea cubeba (Lour.) Pers. J Food Protect 68:581–588.

Categories