Litsea cubeba

From ICG
Jump to navigation Jump to search

Description

Litsea cubeba-1.jpg
  • Litsea cubeba (Lour.) Persoon, which is indigenous to Eastern Asia, is an evergreen tree or shrub belonging to the Lauraceae family. It is considered as a promising industrial crop due to abundant essential oils extracted from the fruit. The essential oil is a pale yellow liquid with a spicy, intensely lemon-like ?avour. It has been widely used as raw materials in chemical industries and also as fragrance enhancers in foods. Besides, essential oils have had a long history of being used in medical industries[1] [2].

Different Developmental Stages & Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
F-BOX[1] F-box protein
  • Universal reference gene
KF706377
  • F:CCGAGCAGGATGATGCTAAT
  • R:AAACAGAGGCCCCCTTTAGA
154 60 SYBR
TUA[1] Tubulin alpha
  • Universal reference gene
KF706381
  • F:GCTGTCCTGCTTGACAATGA
  • R:AAATGGATCCTTGGGTAGGG
200 60 SYBR
EF1α[1] Elongation factor 1-alpha
  • Universal reference gene
KF706375
  • F:TGGTCGTGTTGAGACTGGAG
  • R:GACAAACCCACGCTTCAGAT
184 60 SYBR
UBC[1] Ubiquitin-conjugating enzyme
  • Universal reference gene
KF706383
  • F:TGTGTGTGTGTGTGTGTGTCC
  • R:CCTTTCTCCACGGTCTTCAA
121 60 SYBR
EIF4α[1] Eukaryotic initiation factor 4-alpha
  • Universal reference gene
KF706376
  • F:CGAGGCCCTTGAAATCACT
  • R:GGGTCTCCAACTTCCATTCTT
134 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yangdong Wang
  • Email: wyd11111@126.com
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing 100091, People's Republic of China

Citation Statistics

Cited by 14 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Lin L, Han X, Chen Y, et al. Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba[J]. Molecular genetics and genomics, 2013, 288(12): 727-737.
  2. Luo M, Jiang L, Zou G (2005) Acute and genetic toxicity of essential oil extracted from Litsea cubeba (Lour.) Pers. J Food Protect 68:581–588

[Category:EF1α]]