Litsea cubeba

From ICG
Revision as of 09:03, 16 June 2017 by ICG Expert4 (talk | contribs)
Jump to navigation Jump to search

Description

Litsea cubeba-1.jpg
  • Litsea cubeba (Lour.) Persoon, which is indigenous to Eastern Asia, is an evergreen tree or shrub belonging to the Lauraceae family. It is considered as a promising industrial crop due to abundant essential oils extracted from the fruit. The essential oil is a pale yellow liquid with a spicy, intensely lemon-like ?avour. It has been widely used as raw materials in chemical industries and also as fragrance enhancers in foods. Besides, essential oils have had a long history of being used in medical industries[1] [2].

Different Tissue/Organs & developmental stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
F-BOX[1] F-box protein
  • Universal reference gene
KF706377
  • F:CCGAGCAGGATGATGCTAAT
  • R:AAACAGAGGCCCCCTTTAGA
154 60 SYBR
TUA[1] Tubulin alpha
  • Universal reference gene
KF706381
  • F:GCTGTCCTGCTTGACAATGA
  • R:AAATGGATCCTTGGGTAGGG
200 60 SYBR
EF1α[1] Elongation factor 1-alpha
  • Universal reference gene
KF706375
  • F:TGGTCGTGTTGAGACTGGAG
  • R:GACAAACCCACGCTTCAGAT
184 60 SYBR
UBC[1] Ubiquitin-conjugating enzyme
  • Universal reference gene
KF706383
  • F:TGTGTGTGTGTGTGTGTGTCC
  • R:CCTTTCTCCACGGTCTTCAA
121 60 SYBR
EIF4α[1] Eukaryotic initiation factor 4-alpha
  • Universal reference gene
KF706376
  • F:CGAGGCCCTTGAAATCACT
  • R:GGGTCTCCAACTTCCATTCTT
134 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yangdong Wang
  • Email: wyd11111@126.com
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing 100091, People's Republic of China

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Lin L, Han X, Chen Y, et al. Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba[J]. Molecular genetics and genomics, 2013, 288(12): 727-737.
  2. Luo M, Jiang L, Zou G (2005) Acute and genetic toxicity of essential oil extracted from Litsea cubeba (Lour.) Pers. J Food Protect 68:581–588