Litsea cubeba

Description

Litsea cubeba, indigenous to Eastern Asia, is an evergreen tree or shrub belonging to the Lauraceae family. It is considered as a promising industrial crop due to abundant essential oils extracted from the fruit. The essential oil is a pale yellow liquid with a spicy, intensely lemon-like flavour. It has been widely used as raw materials in chemical industries and also as fragrance enhancers in foods. Besides, essential oils have had a long history of being used in medical industries^[1]^[2].
Common Name: May chang, Aromatic litsea
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
F-BOX^[1]	F-box protein	Different fruit developmental stages Leaves, leaf buds, ﬂower, ﬂower buds, and stems	KF706377	F:CCGAGCAGGATGATGCTAAT R:AAACAGAGGCCCCCTTTAGA	154	60	SYBR
TUA^[1]	Tubulin alpha	Different fruit developmental stages Leaves, leaf buds, ﬂower, ﬂower buds, and stems	KF706381	F:GCTGTCCTGCTTGACAATGA R:AAATGGATCCTTGGGTAGGG	200	60	SYBR
EF1α^[1]	Elongation factor 1-alpha	Different fruit developmental stages Leaves, leaf buds, ﬂower, ﬂower buds, and stems	KF706375	F:TGGTCGTGTTGAGACTGGAG R:GACAAACCCACGCTTCAGAT	184	60	SYBR
UBC^[1]	Ubiquitin-conjugating enzyme	Different fruit developmental stages Leaves, leaf buds, ﬂower, ﬂower buds, and stems	KF706383	F:TGTGTGTGTGTGTGTGTGTCC R:CCTTTCTCCACGGTCTTCAA	121	60	SYBR
EIF4α^[1]	Eukaryotic initiation factor 4-alpha	Different fruit developmental stages Leaves, leaf buds, ﬂower, ﬂower buds, and stems	KF706376	F:CGAGGCCCTTGAAATCACT R:GGGTCTCCAACTTCCATTCTT	134	60	SYBR

Name: Yangdong Wang
Email: wyd11111@126.com
Institution: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing 100091, People's Republic of China

Cited by 15 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 Lin L, Han X, Chen Y, et al. Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba[J]. Molecular genetics and genomics, 2013, 288(12): 727-737.
↑ Luo M, Jiang L, Zou G (2005) Acute and genetic toxicity of essential oil extracted from Litsea cubeba (Lour.) Pers. J Food Protect 68:581–588.