Difference between revisions of "Lolium perenne"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Lolium perenne-1.jpg|right|200px|link=Lolium perenne]]
 
[[File:Lolium perenne-1.jpg|right|200px|link=Lolium perenne]]
−
*'''''Perennial ryegrass''''' (Lolium perenne L.) is dominant forage and turf grass specie in temperate regions due to its good grazing tolerance, extraordinarily high digestibility and adequate seed production. Perennial ryegrass is cultivated in the USA, China, Japan, UK, Australia, New Zealand, South Africa and South America. The species may also aid China in mitigating food shortages issue since it may be capable of producing marketable yields on marginal agricultural land. However, marginal lands are usually afflicted by abiotic stresses such as heat, cold, drought, waterlogging and high salinity, all of which may negatively impact yield, quality, and growth of perennial ryegrass. For example, perennial ryegrass is a drought-susceptible grass species and its leaf extension and appearance rates are both reduced under drought stress. Under waterlogging treatment, the emergence and seedling growth of cv. S.24 perennial ryegrass is significantly reduced in a glasshouse environment, with dry matter yield reduced by up to 25%. Moreover, as a cool season grass, perennial ryegrass has poor heat resistance, making it more likely to die in high-temperature, and high-humidity regions in summer. The susceptibility of perennial ryegrass to freezing temperature also limits its cultivation<ref name="ref1"/><ref name="ref2"/>.
+
*'''''Perennial ryegrass''''' (Lolium perenne L.) is dominant forage and turf grass specie in temperate regions due to its good grazing tolerance, extraordinarily high digestibility and adequate seed production. Perennial ryegrass is cultivated in the USA, China, Japan, UK, Australia, New Zealand, South Africa and South America. The species may also aid China in mitigating food shortages issue since it may be capable of producing marketable yields on marginal agricultural land. <ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''perennial ryegrass'''
 
* <font color=blue>'''Common Name:'''</font> '''perennial ryegrass'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=4522&lvl=3&lin=f&keep=1&srchmode=1&unlock <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=4522&lvl=3&lin=f&keep=1&srchmode=1&unlock <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
=='''''Various Abiotic Stress Conditions'''''==
 
=='''''Various Abiotic Stress Conditions'''''==
 
===Internal Control Genes===
 
===Internal Control Genes===

Revision as of 06:06, 10 August 2017

Description

Lolium perenne-1.jpg
  • Perennial ryegrass (Lolium perenne L.) is dominant forage and turf grass specie in temperate regions due to its good grazing tolerance, extraordinarily high digestibility and adequate seed production. Perennial ryegrass is cultivated in the USA, China, Japan, UK, Australia, New Zealand, South Africa and South America. The species may also aid China in mitigating food shortages issue since it may be capable of producing marketable yields on marginal agricultural land. [1][2].
  • Common Name: perennial ryegrass
  • NCBI Taxonomy

Various Abiotic Stress Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
eIF4A[1] Eukaryotic initiation factor 4 alpha
  • Drought stress
  • Salt stress
  • Heat stress
  • ABA
  • Waterlogging treatments
 GO924770
  • F:AACTCAACTTGAAGTGTTGGAGTG
  • R:AGATCTGGTCCTGGAAAGAATATG
 168 60 SYBR
TEF1[1] Transcription elongation factor 1
  • Drought stress
  • Salt stress
  • ABA
  • Waterlogging treatments
 GR522099
  • F:CGTGTGATCGAGAGGTTTGA
  • R:CGAATTTCCAGAGGGCAATA
 133 60 SYBR
TBP-1[1] Tat binding protein-1
  • Drought stress
  • Salt stress
  • Heat stress
 GO924783
  • F:TGCTTAGTTCCCCTAAGATAGTGA
  • R:CTGAGACCAAACACGATTTCA
 112 60 SYBR
E2[1] Ubiquitin-conjugating enzyme
  • Heat stress
  • ABA
 GO924794
  • F:CGGTTCTGTGCCAAAATGT
  • R:CAGCTATCTCCAACGGTTCA
 111 60 SYBR
UBQ[1] Ubiquitin
  • Waterlogging treatments
 GR510338
  • F:AAAATTCCCCAATCAATCTCCT
  • R:CTTCACAAAGATCTGCATCTTGA
 89 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Xinquan Zhang
  • Email: zhangxq@sicau.edu.cn
  • Institute: Department of Grassland Science, Animal Science and Technology College, Sichuan Agricultural University, Ya’an, Sichuan, China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Huang L, Yan H, Jiang X, Yin G, Zhang X, Qi X, Zhang Y, Yan Y, Ma X, Peng Y. Identification of candidate reference genes in perennial ryegrass for quantitative RT-PCR under various abiotic stress conditions. PLoS One. 2014 Apr 3;9(4):e93724. doi: 10.1371/journal.pone.0093724. eCollection 2014. PubMed PMID: 24699822; PubMed Central PMCID: PMC3974806.
  2. ↑ Wilkins PW, Humphreys MO (2003) Progress in breeding perennial forage grasses for temperate agriculture. J Agric Sci 140: 129–150.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Lolium_perenne&oldid=7529"