Lolium perenne

Description

Lolium perenne (Perennial ryegrass) is dominant forage and turf grass specie in temperate regions due to its good grazing tolerance, extraordinarily high digestibility and adequate seed production. Perennial ryegrass is cultivated in the USA, China, Japan, UK, Australia, New Zealand, South Africa and South America. The species may also aid China in mitigating food shortages issue since it may be capable of producing marketable yields on marginal agricultural land ^[1]^[2].
Common Name: perennial ryegrass
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
eIF4A^[1]	Eukaryotic initiation factor 4 alpha	Drought stress Salt stress Heat stress ABA Waterlogging treatments	GO924770	F:AACTCAACTTGAAGTGTTGGAGTG R:AGATCTGGTCCTGGAAAGAATATG	168	60	SYBR
TEF1^[1]	Transcription elongation factor 1	Drought stress Salt stress ABA Waterlogging treatments	GR522099	F:CGTGTGATCGAGAGGTTTGA R:CGAATTTCCAGAGGGCAATA	133	60	SYBR
TBP-1^[1]	Tat binding protein-1	Drought stress Salt stress Heat stress	GO924783	F:TGCTTAGTTCCCCTAAGATAGTGA R:CTGAGACCAAACACGATTTCA	112	60	SYBR
E2^[1]	Ubiquitin-conjugating enzyme	Heat stress ABA	GO924794	F:CGGTTCTGTGCCAAAATGT R:CAGCTATCTCCAACGGTTCA	111	60	SYBR
UBQ^[1]	Ubiquitin	Waterlogging treatments	GR510338	F:AAAATTCCCCAATCAATCTCCT R:CTTCACAAAGATCTGCATCTTGA	89	60	SYBR

Name: Xinquan Zhang
Email: zhangxq@sicau.edu.cn
Institute: Department of Grassland Science, Animal Science and Technology College, Sichuan Agricultural University, Ya’an, Sichuan, China

Cited by ?? (Based on Google Scholar [2017-08-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 Huang L, Yan H, Jiang X, Yin G, Zhang X, Qi X, Zhang Y, Yan Y, Ma X, Peng Y. Identification of candidate reference genes in perennial ryegrass for quantitative RT-PCR under various abiotic stress conditions. PLoS One. 2014 Apr 3;9(4):e93724. doi: 10.1371/journal.pone.0093724. eCollection 2014. PubMed PMID: 24699822; PubMed Central PMCID: PMC3974806.
↑ Wilkins PW, Humphreys MO (2003) Progress in breeding perennial forage grasses for temperate agriculture. J Agric Sci 140: 129–150.