Difference between revisions of "Lolium spp"

From ICG
Jump to navigation Jump to search
Line 79: Line 79:
 
</references>
 
</references>
 
[[Category:Plants]] [[Category:mRNA]] [[Category:StepOnePlus]]
 
[[Category:Plants]] [[Category:mRNA]] [[Category:StepOnePlus]]
 +
[[Category:CAP]] [[Category:GAPDH]] [[Category:Ubiquitin]]

Revision as of 09:02, 19 June 2017

Description

Lolium temulentum-1.jpg
  • The most important pasture-grass species for temperate zones is perennial ryegrass (Lolium perenne L.), which is cultivated for dairy, meat, and wool production and is also an important turf- and amenity-grass species. Perennial ryegrass is a member of family Poaceae and is, therefore, related to more extensively studied grass species, such as the cereals wheat, barley, maize, and rice[1] [2].

Resistant to Acetolactate-Synthase Inhibitors

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CAP[1] cap-binding protein
  • Herbicide response in other weed species
EU328530
  • F:CTCCAGGGAAGATGCTGAAG
  • R:CTTGAAAGCCCCAATCAAAA
95 57 StepOnePlus
GAPDH[1] glyceraldehyde-3-phosphate-dehydrogenase
  • Herbicide response in other weed species
EU328533
  • F:AGGTTATCAATGACAAGTTTGG
  • R:ATCAACAGTCTTCTGGGTAGC
83 60 StepOnePlus
UBQ[1] ubiquitin
  • Herbicide response in other weed species
EF470423
  • F:CAAGAAGAAGACGTACACCAAG
  • R:GACCTTGTAGAACTGGAGGAG
85 57 StepOnePlus

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Christophe Délye
  • Email: delye@dijon.inra.fr
  • Institution:INRA, UMR1347 Agroécologie, Dijon, France

Citation Statistics

Cited by 21 (Based on Google Scholar [2017-06-16])


References

  1. 1.0 1.1 1.2 1.3 Duhoux A, Délye C. Reference genes to study herbicide stress response in Lolium sp.: up-regulation of P450 genes in plants resistant to acetolactate-synthase inhibitors[J]. PloS one, 2013, 8(5): e63576.
  2. Holmes, W. 1980. Grass: its production and utilisation. Blackwell Scientific Publications, Oxford.