Difference between revisions of "Lucilia cuprina"

From ICG
Jump to navigation Jump to search
 
(11 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Lucilia cuprina.png|right|200px|link=Lucilia cuprina]]
 +
*'''''Lucilia cuprina''''',is an important pest of sheep in Australia and other parts of the world. It is a member of the order Diptera, has a pair of short but very strong membranous wings and a pair of hindwings reduced and modified to clublike balancers known as halteres. It is of significant concern as a result of the welfare issues and production losses that arise when gravid female blow flies deposit eggs on sheep, giving rise to fly strike. It is an important ecto-parasite that causes fly strike, which has significant health and welfare, as well as economic, impacts on the sheep industry in Australia<ref name="ref1"/> <ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Australian sheep blowfly'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=7375 <font color=blue>'''NCBI Taxonomy'''</font>]
  
[[File:Lucilia cuprina-1.jpg|right|327px|]]
 
* Lucilia cuprina (Wiedemann),is an important pest of sheep in Australia and other parts of the world. However, the paucity of information on many fundamental molecular aspects of this species limits the ability to exploit functional genomics techniques for the discovery of new drug targets for its control.
 
* It is of significant concern as a result of the welfare issues and production losses that arise when gravid female blowflies deposit eggs on sheep, giving rise to fly strike. It  is an important ecto-parasite that causes fly strike, which has significant health and welfare, as well as economic, impacts on the sheep industry in Australia<ref name="ref1"/> <ref name="ref2"/>.
 
 
=='''''Different Developmental Stages'''''==
 
=='''''Different Developmental Stages'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 20: Line 21:
 
|align="center"| 18S rRNA
 
|align="center"| 18S rRNA
 
|
 
|
*All life stages
+
* Eggs, L1, L3, pupae and adult life stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AF322425 '''AF322425''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AF322425 '''AF322425''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 32: Line 33:
 
|align="center"| 28S rRNA
 
|align="center"| 28S rRNA
 
|
 
|
*All life stages
+
* Eggs, L1, L3, pupae and adult life stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU626548 '''EU626548''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU626548 '''EU626548''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 44: Line 45:
 
|align="center"| Glutathione S-transferase
 
|align="center"| Glutathione S-transferase
 
|
 
|
*All life stages
+
* Eggs, L1, L3, pupae and adult life stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L23126 '''L23126''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L23126 '''L23126''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 56: Line 57:
 
|align="center"| β-tubulin  
 
|align="center"| β-tubulin  
 
|
 
|
*All life stages
+
* Eggs, L1, L3, pupae and adult life stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/283826465 '''GQ284558''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/283826465 '''GQ284558''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 68: Line 69:
 
|align="center"| Acidic ribosomal phosphoprotein PO  
 
|align="center"| Acidic ribosomal phosphoprotein PO  
 
|
 
|
*All life stages
+
* Eggs, L1, L3, pupae and adult life stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/283826461 '''GQ284556''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/283826461 '''GQ284556''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 89: Line 90:
 
*'''Institution''': CSIRO (Commonwealth Scientific & Industrial Research Organization) Livestock Industries, St. Lucia, Brisbane, Queensland, Australia
 
*'''Institution''': CSIRO (Commonwealth Scientific & Industrial Research Organization) Livestock Industries, St. Lucia, Brisbane, Queensland, Australia
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''27''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=13106900199333312026&as_sdt=2005&sciodt=0,5&hl=en '''28'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 100: Line 101:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Animals]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:Animals]] [[Category:mRNA]] [[Category:SYBR]]
[[Category:18S rRNA]] [[Category:28S rRNA]] [[Category:GST1]] [[Category:RPL]] [[Category:Ubiquitin]]
+
[[Category:18S rRNA]] [[Category:Other rRNA]] [[Category:GST1]] [[Category:RPL]] [[Category:Tubulin]]
 
[[Category:Different Developmental Stages]]
 
[[Category:Different Developmental Stages]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 07:29, 1 September 2017

Description

Lucilia cuprina.png
  • Lucilia cuprina,is an important pest of sheep in Australia and other parts of the world. It is a member of the order Diptera, has a pair of short but very strong membranous wings and a pair of hindwings reduced and modified to clublike balancers known as halteres. It is of significant concern as a result of the welfare issues and production losses that arise when gravid female blow flies deposit eggs on sheep, giving rise to fly strike. It is an important ecto-parasite that causes fly strike, which has significant health and welfare, as well as economic, impacts on the sheep industry in Australia[1] [2].
  • Common Name: Australian sheep blowfly
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S rRNA[1] 18S rRNA
  • Eggs, L1, L3, pupae and adult life stages
AF322425
  • F:AGCAGTTTGGGGGCATTAG
  • R:AGCAGTTTGGGGGCATTAG
NA NA SYBR
28S rRNA[1] 28S rRNA
  • Eggs, L1, L3, pupae and adult life stages
EU626548
  • F:CCAAAGAGTCGTGTTGCTTG
  • R:ATTCAGGTTCATCGGGCTTA
NA NA SYBR
GST1[1] Glutathione S-transferase
  • Eggs, L1, L3, pupae and adult life stages
L23126
  • F:GCCAGTGTCAGCACCTTTG
  • R:GCAACCTTCCCAGTTTTCATC
NA NA SYBR
β-tubulin[1] β-tubulin
  • Eggs, L1, L3, pupae and adult life stages
GQ284558
  • F:AAGCTGACGACACCCACATAC
  • R:CGGGCATGAAGAAGTGAAGA
NA NA SYBR
RPLPO[1] Acidic ribosomal phosphoprotein PO
  • Eggs, L1, L3, pupae and adult life stages
GQ284556
  • F:ACCCATAAGGACGACACC
  • R:GGTGCTGACAATGTTGGTTC
NA NA SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: A.C.KOTZE
  • Email: andrew.kotze@csiro.au
  • Institution: CSIRO (Commonwealth Scientific & Industrial Research Organization) Livestock Industries, St. Lucia, Brisbane, Queensland, Australia

Citation Statistics

Cited by 28 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Bagnall N H, Kotze A C. Evaluation of reference genes for real‐time PCR quantification of gene expression in the Australian sheep blowfly, Lucilia cuprina[J]. Medical and veterinary entomology, 2010, 24(2): 176-181.
  2. Bagnall NH, Hines BM, Lucke AJ, Gupta PK, Reid RC, Fairlie DP, Kotze AC.Int J Parasitol Drugs Drug Resist. 2017 Apr;7(1):51-60. doi: 10.1016/j.ijpddr.2017.01.001. Epub 2017 Jan 10.PMID: 28110187 Free PMC Article.

Categories