Lucilia cuprina

From ICG
Jump to navigation Jump to search

Description

Lucilia cuprina-1.jpg
  • Lucilia cuprina (Wiedemann),is an important pest of sheep in Australia and other parts of the world. However, the paucity of information on many fundamental molecular aspects of this species limits the ability to exploit functional genomics techniques for the discovery of new drug targets for its control.
  • It is of significant concern as a result of the welfare issues and production losses that arise when gravid female blowflies deposit eggs on sheep, giving rise to fly strike. It is an important ecto-parasite that causes fly strike, which has significant health and welfare, as well as economic, impacts on the sheep industry in Australia[1] [2].

Different Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S rRNA[1] 18S rRNA
  • All life stages
AF322425
  • F:AGCAGTTTGGGGGCATTAG
  • R:AGCAGTTTGGGGGCATTAG
NA NA SYBR
28S rRNA[1] 28S rRNA
  • All life stages
EU626548
  • F:CCAAAGAGTCGTGTTGCTTG
  • R:ATTCAGGTTCATCGGGCTTA
NA NA SYBR
GST1[1] Glutathione S-transferase
  • All life stages
L23126
  • F:GCCAGTGTCAGCACCTTTG
  • R:GCAACCTTCCCAGTTTTCATC
NA NA SYBR
β-tubulin[1] β-tubulin
  • All life stages
GQ284558
  • F:AAGCTGACGACACCCACATAC
  • R:CGGGCATGAAGAAGTGAAGA
NA NA SYBR
RPLPO[1] Acidic ribosomal phosphoprotein PO
  • All life stages
GQ284556
  • F:ACCCATAAGGACGACACC
  • R:GGTGCTGACAATGTTGGTTC
NA NA SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: A.C.KOTZE
  • Email: andrew.kotze@csiro.au
  • Institution: CSIRO (Commonwealth Scientific & Industrial Research Organization) Livestock Industries, St. Lucia, Brisbane, Queensland, Australia

Citation Statistics

Cited by 27 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Bagnall N H, Kotze A C. Evaluation of reference genes for real‐time PCR quantification of gene expression in the Australian sheep blowfly, Lucilia cuprina[J]. Medical and veterinary entomology, 2010, 24(2): 176-181.
  2. Bagnall NH, Hines BM, Lucke AJ, Gupta PK, Reid RC, Fairlie DP, Kotze AC.Int J Parasitol Drugs Drug Resist. 2017 Apr;7(1):51-60. doi: 10.1016/j.ijpddr.2017.01.001. Epub 2017 Jan 10.PMID: 28110187 Free PMC Article.