Difference between revisions of "Lycium barbarum"

Revision as of 09:33, 25 June 2017

Lycium barbarum L. is a perennial bush common to most areas of China, Europe, and the Mediterranean region.
Its fruits have been used for centuries in China as a traditional herbal medicine and as a valuable nourishing tonic. L. barbarum fruits contain active compounds, L. barbarum polysaccharides, which have been shown to reduce cancer risk and delay senescence, moisturize the lungs and improve vision. Lycium barbarum fruits can be used to produce various types of healthy products and foods, e.g., medicinal beverages and drinks, and healthy dietary soups.^[1] ^[2] ^[3].

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
GAPDH^[1]	Glyceraldehyde-3-phosphate dehydrogenase-like	Different fruit developmental stages	JX427558	F:GACAACTACTCACTCTTACACCG R:GTTCGGGAGGACAAGGGAAA	150	60	SYBR
EF1a^[1]	Elongation factor 1 alpha-like	Different fruit developmental stages	JX427558	F:CCATACCAGCATCACCATTCTTC R:GTCACACTTCCCACATTGCC	117	60	SYBR

Cited by 16 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 Wang L, Wang Y, Zhou P. Validation of reference genes for quantitative real-time PCR during Chinese wolfberry fruit development[J]. Plant physiology and biochemistry, 2013, 70: 304-310.
↑ Luo Q, Cai Y, Yan J, Sun M, Corke H. Hypoglycemic and hypolipidemic effects and antioxidant activity of fruit extracts from Lycium barbarum. Life Sci. 2004 Nov 26;76(2):137-49. PubMed PMID: 15519360.
↑ Q.Y. Li Healthy Functions and Medicinal Prescriptions of Lycium barbarum (Gou Ji Zi), Jindun Press, Beijing (2001), pp. 1–16.

@@ Line 2: / Line 2: @@
 [[File:Lycium barbarum-1.jpg|right|327px|]]
-* Lycium barbarum L. is a perennial bush common to most areas of China, Europe, and the Mediterranean region.
+* '''''Lycium barbarum L.''''' is a perennial bush common to most areas of China, Europe, and the Mediterranean region.
-* Its fruits have been used for centuries in China as a traditional herbal medicine and as a valuable nourishing tonic. The earliest Chinese medicinal monograph documented medicinal use of Lycium barbarum around 2300 years ago.
+* Its fruits have been used for centuries in China as a traditional herbal medicine and as a valuable nourishing tonic. L. barbarum fruits contain active compounds, L. barbarum polysaccharides, which have been shown to reduce cancer risk and delay senescence, moisturize the lungs and improve vision. Lycium barbarum fruits can be used to produce various types of healthy products and foods, e.g., medicinal beverages and drinks, and healthy dietary soups.<ref name="ref1"/> <ref name="ref2"/> <ref name="ref3"/>.
-* L. barbarum fruits contain active compounds, L. barbarum polysaccharides, which have been shown to reduce cancer risk and delay senescence, moisturize the lungs and improve vision. Lycium barbarum fruits can be used to produce various types of healthy products and foods, e.g., medicinal beverages and drinks, and healthy dietary soups<ref name="ref1"/> <ref name="ref2"/> <ref name="ref3"/>.
 =='''''Fruit Development'''''==