Difference between revisions of "Lycium barbarum"

From ICG
Jump to navigation Jump to search
 
(8 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
  
[[File:Lycium barbarum-1.jpg|right|327px|]]
+
[[File:Lycium barbarum.png|right|200px|link=Lycium barbarum]]
* '''''Lycium barbarum L.''''' is a perennial bush common to most areas of China, Europe, and the Mediterranean region.  
+
* '''''Lycium barbarum L.''''' is a perennial bush common to most areas of China, Europe, and the Mediterranean region. Its fruits have been used for centuries in China as a traditional herbal medicine and as a valuable nourishing tonic because its fruits contain active compounds which have been shown to reduce cancer risk and delay senescence, moisturize the lungs and improve vision. Nowadays, its fruits is used to produce various types of healthy products and foods and healthy dietary soups<ref name="ref1"/><ref name="ref2"/><ref name="ref3"/>.
* Its fruits have been used for centuries in China as a traditional herbal medicine and as a valuable nourishing tonic. L. barbarum fruits contain active compounds, L. barbarum polysaccharides, which have been shown to reduce cancer risk and delay senescence, moisturize the lungs and improve vision. Lycium barbarum fruits can be used to produce various types of healthy products and foods, e.g., medicinal beverages and drinks, and healthy dietary soups.<ref name="ref1"/> <ref name="ref2"/> <ref name="ref3"/>.
 
 
* <font color=blue>'''Common Name:'''</font> '''Goji'''
 
* <font color=blue>'''Common Name:'''</font> '''Goji'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=112863 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=112863 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Fruit Development'''''==
 
=='''''Fruit Development'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 56: Line 55:
 
*'''Institution''': Ningxia University, 750021 Yinchuan, PR China
 
*'''Institution''': Ningxia University, 750021 Yinchuan, PR China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''16''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=11358947290396252581&as_sdt=2005&sciodt=0,5&hl=en'''18'''] (Based on Google Scholar [2017-09-01])
 
 
  
 
=='''References'''==
 
=='''References'''==
Line 71: Line 69:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]]
+
=='''Categories'''==
[[Category:mRNA]] [[Category:SYBR]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:EF1α]][[Category:GAPDH]][[Category:Fruit Development]][[Category:geNorm]][[Category:NormFinder]]
[[Category:EF1α]] [[Category:GAPDH]]
 
[[Category:Fruit Development]]
 

Latest revision as of 07:09, 1 September 2017

Description

Lycium barbarum.png
  • Lycium barbarum L. is a perennial bush common to most areas of China, Europe, and the Mediterranean region. Its fruits have been used for centuries in China as a traditional herbal medicine and as a valuable nourishing tonic because its fruits contain active compounds which have been shown to reduce cancer risk and delay senescence, moisturize the lungs and improve vision. Nowadays, its fruits is used to produce various types of healthy products and foods and healthy dietary soups[1][2][3].
  • Common Name: Goji
  • NCBI Taxonomy

Fruit Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase-like
  • Different fruit developmental stages
JX427558
  • F:GACAACTACTCACTCTTACACCG
  • R:GTTCGGGAGGACAAGGGAAA
150 60 SYBR
EF1a[1] Elongation factor 1 alpha-like
  • Different fruit developmental stages
JX427558
  • F:CCATACCAGCATCACCATTCTTC
  • R:GTCACACTTCCCACATTGCC
117 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Lijuan Wang
  • Email: lijuanwang279@hotmail.com
  • Institution: Ningxia University, 750021 Yinchuan, PR China

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Wang L, Wang Y, Zhou P. Validation of reference genes for quantitative real-time PCR during Chinese wolfberry fruit development[J]. Plant physiology and biochemistry, 2013, 70: 304-310.
  2. Luo Q, Cai Y, Yan J, Sun M, Corke H. Hypoglycemic and hypolipidemic effects and antioxidant activity of fruit extracts from Lycium barbarum. Life Sci. 2004 Nov 26;76(2):137-49. PubMed PMID: 15519360.
  3. Q.Y. Li Healthy Functions and Medicinal Prescriptions of Lycium barbarum (Gou Ji Zi), Jindun Press, Beijing (2001), pp. 1–16.

Categories