Lycium barbarum

From ICG
Jump to navigation Jump to search

Description

Lycium barbarum-1.jpg
  • Lycium barbarum L. is a perennial bush common to most areas of China, Europe, and the Mediterranean region.
  • Its fruits have been used for centuries in China as a traditional herbal medicine and as a valuable nourishing tonic. L. barbarum fruits contain active compounds, L. barbarum polysaccharides, which have been shown to reduce cancer risk and delay senescence, moisturize the lungs and improve vision. Lycium barbarum fruits can be used to produce various types of healthy products and foods, e.g., medicinal beverages and drinks, and healthy dietary soups.[1] [2] [3].
  • Common Name: Goji
  • NCBI Taxonomy

Fruit Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase-like
  • Different fruit developmental stages
JX427558
  • F:GACAACTACTCACTCTTACACCG
  • R:GTTCGGGAGGACAAGGGAAA
150 60 SYBR
EF1a[1] Elongation factor 1 alpha-like
  • Different fruit developmental stages
JX427558
  • F:CCATACCAGCATCACCATTCTTC
  • R:GTCACACTTCCCACATTGCC
117 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Lijuan Wang
  • Email: lijuanwang279@hotmail.com
  • Institution: Ningxia University, 750021 Yinchuan, PR China

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-06-16])


References

  1. 1.0 1.1 1.2 Wang L, Wang Y, Zhou P. Validation of reference genes for quantitative real-time PCR during Chinese wolfberry fruit development[J]. Plant physiology and biochemistry, 2013, 70: 304-310.
  2. Luo Q, Cai Y, Yan J, Sun M, Corke H. Hypoglycemic and hypolipidemic effects and antioxidant activity of fruit extracts from Lycium barbarum. Life Sci. 2004 Nov 26;76(2):137-49. PubMed PMID: 15519360.
  3. Q.Y. Li Healthy Functions and Medicinal Prescriptions of Lycium barbarum (Gou Ji Zi), Jindun Press, Beijing (2001), pp. 1–16.