Difference between revisions of "Lycoris aurea"

Revision as of 08:48, 17 August 2017

Lycoris aurea (L' Hér.) Herb, also called Golden Magic Lily, is an ornamentally and medicinally important species of the Amaryllidaceae family. It belonged to the genus Lycoris which composed of approximately 20 species of flowering plants native to the moist warm temperate woodlands of eastern and southern Asia. Like other species of genus Lycois, L. aurea is very durable, tolerating the extremes of drought and waterlogging, as well as poor soil conditions. It also accumulates Amaryllidaceae alkaloids such as lycorine and galanthamine, which have been reported to exhibit medical values. In general, Amaryllidaceae alkaloids are regarded as derivatives of the common precursor 4′-O-methylnorbelladine ^[1].
Common Name: Golden Magic Lily
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
EXP1^[1]	Expressed protein 1	All samples NaCl stress Heat stress, polyethylene glycol (PEG) stress and ABA treatment Various tissues	GBXB01024031	F:ATTGAAACAACCTACACCGCAA R:GCTGTAAGAATGCTAATCGTTCA	133	60	SYBR
TIP41^[1]	TIP41-like protein	All samples Methyl jasmonate(MeJA) treatment Various tissues	HACC01023453	F:GCAACCATCCAAAGTTTAACTGCT R:AATGTGCAAGCAGGGCTAGTAA	157	60	SYBR
UBC^[1]	Ubiquitin-conjugating enzyme	NaCl stress Cold stress	NA	F:TGCCTTGACCATCTCCAAGGTT R:CTCAACTATCCATCCGCTCACCC	200	60	SYBR
PTBP1^[1]	Polypyrimidine tract-binding protein 1	Heat stress, polyethylene glycol (PEG) stress and ABA treatment Sodium nitroprusside (SNP) treatment	HACC01018615	F:GCAATTTTTGAGAAGAATGGTG R:GACAGATGAAGCTTACAGTAAC	131	60	SYBR
CYP2^[1]	Cyclophilin 2	Cold stress	GBXB01024543	F:TCCCGATTCTTCTGGAAAGG R:AAGCCTTGTCTGGTAGAACAGC	181	60	SYBR
PP2A^[1]	Serine/threonine-protein phosphatase 2A	Sodium nitroprusside (SNP) treatment	NA	F:GTACCGAACATTAAATTCAAT R:CTTGATTTGCAAAATATCTGAC	176	60	SYBR
CYP1^[1]	Cyclophilin 1	Methyl jasmonate(MeJA) treatment	HACC01018398	F:TCGTGAGGGCCATCGAGAAGGT R:CTCATAACAAACAGACCATTATT	137	60	SYBR

Name: Ren Wang
Email: jswangren@aliyun.com
Institution: Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing, China

Cited by 8 (Based on Google Scholar [2017-08-10])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Ma R, Xu S, Zhao Y, Xia B, Wang R. Selection and Validation of Appropriate Reference Genes for Quantitative Real-Time PCR Analysis of Gene Expression in Lycoris aurea. Front Plant Sci. 2016 Apr 25;7:536. doi: 10.3389/fpls.2016.00536. eCollection 2016. PubMed PMID: 27200013; PubMed Central PMCID: PMC4843812.

@@ Line 120: / Line 120: @@
 *'''Name''': Ren Wang
 *'''Email''': jswangren@aliyun.com
-*'''Institute''': Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing, China
+*'''Institution''': Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing, China
 ===Citation Statistics===
 Cited by '''8''' (Based on Google Scholar [2017-08-10])