Difference between revisions of "Macaca fascicularis"

From ICG
Jump to navigation Jump to search
 
(13 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
  
[[File:Macaca fascicularis-1.jpg|right|327px|]]
+
[[File:Macaca fascicularis.png|right|200px|link=Macaca fascicularis]]
* The cynomolgus monkey (Macaca fascicularis) is one of the most commonly used nonhuman primate animal models for studying various diseases, such as inflammation, atherogenesis, chronic wasting disease (CWD), amyotrophic lateral sclerosis (ALS), Parkinson’s disease, Alzheimer’s disease, and chikungunya disease because of its biological and behavioral similarities to, and close genetic relationship with, humans. Among the genus Macaca, the rhesus monkey (Macaca mulatta) is more widely used than the cynomolgus monkey for biomedical research.
+
* '''''Macaca fascicularis''''' is one of the most commonly used nonhuman primate animal models for studying various diseases, such as inflammation, atherogenesis, chronic wasting disease (CWD), amyotrophic lateral sclerosis (ALS), Parkinson’s disease, Alzheimer’s disease, and chikungunya disease because of its biological and behavioral similarities to, and close genetic relationship with, humans<ref name="ref1"/><ref name="ref2"/>.
* However, studies using rhesus monkeys were restricted due to an export ban of the rhesus monkey from India in 1977. This restriction led to the increased use of the cynomolgus monkey in various studies. Moreover, the cynomolgus monkey has several advantages over the rhesus monkey, including easy handling due to its smaller body size and weight, low cost and ease of availability, and lack of seasonal fertility.
+
* <font color=blue>'''Common Name:'''</font> '''Crab-eating macaque'''
* Moreover, researchers have access to more abundant gene information via numerous full-length mRNA sequences than in the case of rhesus macaques. Therefore, the cynomolgus monkey could be a valuable experimental nonhuman primate animal model for various studies<ref name="ref1"/> <ref name="ref2"/>.  
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9541 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Whole-body Tissues'''''==
 
=='''''Different Whole-body Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 22: Line 22:
 
|align="center"| ADP-ribosylation factor GTPase activating protein 2
 
|align="center"| ADP-ribosylation factor GTPase activating protein 2
 
|
 
|
* Universal reference gene
+
* Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 34: Line 34:
 
|align="center"| Morf4 family associated protein 1
 
|align="center"| Morf4 family associated protein 1
 
|
 
|
* Universal reference gene
+
* Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 46: Line 46:
 
|align="center"| ADP-ribosylation factor-like 1
 
|align="center"| ADP-ribosylation factor-like 1
 
|
 
|
* Universal reference gene
+
* Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 56: Line 56:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 67: Line 68:
 
*'''Institution''': National Primate Research Center, Korea Research Institute of Bioscience and Biotechnology, Chungbuk, Republic of Korea
 
*'''Institution''': National Primate Research Center, Korea Research Institute of Bioscience and Biotechnology, Chungbuk, Republic of Korea
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''15''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=13900378274713463793&as_sdt=2005&sciodt=0,5&hl=en '''15'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 78: Line 79:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Animals]] [[Category:mRNA]] [[Category:SYBR]]
+
=='''Categories'''==
 +
[[Category:Animals]] [[Category:mRNA]][[Category:SYBR]]
 
[[Category:ARF]] [[Category:ARF]] [[Category:MRFAP1]]
 
[[Category:ARF]] [[Category:ARF]] [[Category:MRFAP1]]
 
[[Category:Different Tissues]]
 
[[Category:Different Tissues]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 08:28, 1 September 2017

Description

Macaca fascicularis.png
  • Macaca fascicularis is one of the most commonly used nonhuman primate animal models for studying various diseases, such as inflammation, atherogenesis, chronic wasting disease (CWD), amyotrophic lateral sclerosis (ALS), Parkinson’s disease, Alzheimer’s disease, and chikungunya disease because of its biological and behavioral similarities to, and close genetic relationship with, humans[1][2].
  • Common Name: Crab-eating macaque
  • NCBI Taxonomy

Different Whole-body Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ARFGAP2[1] ADP-ribosylation factor GTPase activating protein 2
  • Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus
NA
  • F:GCGTCCATCTGAGCTTCATC
  • R:CATCATTGGCTGTGCATCCA
135 60 SYBR
MRFAP1[1] Morf4 family associated protein 1
  • Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus
NA
  • F:GCGGATAGAGAAGAGCGAGT
  • R:AGCCAATCTCCACCAGTTGA
82 60 SYBR
ARL1[1] ADP-ribosylation factor-like 1
  • Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus
NA
  • F:AGACAGTTGTGACCGAGACC
  • R:TGAGGAAGTCATGGCCTGTT
136 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Heui-Soo Kim
  • Email: khs307@pusan.ac.kr
  • Institution: National Primate Research Center, Korea Research Institute of Bioscience and Biotechnology, Chungbuk, Republic of Korea

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Park S J, Kim Y H, Huh J W, et al. Selection of new appropriate reference genes for RT-qPCR analysis via transcriptome sequencing of cynomolgus monkeys (Macaca fascicularis)[J]. PLoS One, 2013, 8(4): e60758.
  2. De Pablos V, Barcia C, Martinez S, Gomez A, Ros-Bernal F, et al. (2009) MPTP administration increases plasma levels of acute phase proteins in non-human primates (Macaca fascicularis). Neurosci Lett 463: 37–39.

Categories