Difference between revisions of "Macaca fascicularis"

From ICG
Jump to navigation Jump to search
Line 14: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]

Revision as of 14:19, 20 June 2017

Description

Macaca fascicularis-1.jpg
  • The cynomolgus monkey (Macaca fascicularis) is one of the most commonly used nonhuman primate animal models for studying various diseases, such as inflammation, atherogenesis, chronic wasting disease (CWD), amyotrophic lateral sclerosis (ALS), Parkinson’s disease, Alzheimer’s disease, and chikungunya disease because of its biological and behavioral similarities to, and close genetic relationship with, humans. Among the genus Macaca, the rhesus monkey (Macaca mulatta) is more widely used than the cynomolgus monkey for biomedical research.
  • However, studies using rhesus monkeys were restricted due to an export ban of the rhesus monkey from India in 1977. This restriction led to the increased use of the cynomolgus monkey in various studies. Moreover, the cynomolgus monkey has several advantages over the rhesus monkey, including easy handling due to its smaller body size and weight, low cost and ease of availability, and lack of seasonal fertility.
  • Moreover, researchers have access to more abundant gene information via numerous full-length mRNA sequences than in the case of rhesus macaques. Therefore, the cynomolgus monkey could be a valuable experimental nonhuman primate animal model for various studies[1] [2].

Different Whole-body Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ARFGAP2[1] ADP-ribosylation factor GTPase activating protein 2
  • Universal reference gene
NA
  • F:GCGTCCATCTGAGCTTCATC
  • R:CATCATTGGCTGTGCATCCA
135 60 SYBR
MRFAP1[1] Morf4 family associated protein 1
  • Universal reference gene
NA
  • F:GCGGATAGAGAAGAGCGAGT
  • R:AGCCAATCTCCACCAGTTGA
82 60 SYBR
ARL1[1] ADP-ribosylation factor-like 1
  • Universal reference gene
NA
  • F:AGACAGTTGTGACCGAGACC
  • R:TGAGGAAGTCATGGCCTGTT
136 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Heui-Soo Kim
  • Email: khs307@pusan.ac.kr
  • Institution: National Primate Research Center, Korea Research Institute of Bioscience and Biotechnology, Chungbuk, Republic of Korea

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Park S J, Kim Y H, Huh J W, et al. Selection of new appropriate reference genes for RT-qPCR analysis via transcriptome sequencing of cynomolgus monkeys (Macaca fascicularis)[J]. PLoS One, 2013, 8(4): e60758.
  2. De Pablos V, Barcia C, Martinez S, Gomez A, Ros-Bernal F, et al. (2009) MPTP administration increases plasma levels of acute phase proteins in non-human primates (Macaca fascicularis). Neurosci Lett 463: 37–39.