Difference between revisions of "Macrobrachium olfersii"

From ICG
Jump to navigation Jump to search
Line 79: Line 79:
  
 
[[Category:Animals]]
 
[[Category:Animals]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:21, 19 June 2017

Description

REFqPCR2017002-1.jpg
  • The freshwater prawn (Macrobrachium olfersii) has wide distribution in the Americas and is emerging as a potential model for development, developmental toxicity and environmental toxicology studies.Macrobrachium olfersii exhibits physiological characteristics typical of a recent freshwater invader, but is still dependent on brackish water for larval development and metamorphosis
  • The embryonic development of Macrobrachium olfersii has been well-characterized both morphologically and chronologically. However, the molecular mechanisms of this species, including its development, particularly in the embryonic stages, remained unknown. [1] [2]

Different Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RpL8[1] ribosomal protein L8 (RpL8)
  • Embryonic development
KY027065
  • F:GTATTGTTGCTGGTGGAGGTC
  • R:GTATTGTTGCTGGTGGAGGTC
125 60 GoTaq
RpS6[1] Ribosomal protein S6 (RpS6)
  • Embryonic development
KY027064
  • F:CTGTCTGTACTTGCCCTGATG
  • R:CTGTCTGTACTTGCCCTGATG
78 60 GoTaq

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Evelise M. Nazari
  • Email: evelise.nazari@ufsc.br
  • Institution: Universidade Federal de Santa Catarina, Departamento de Biologia Celular, Embriologia e Genética, 88040-900 Florianópolis, Santa Catarina, Brazil

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Jaramillo ML, Ammar D, Quispe RL, Guzman F, Margis R, Nazari EM, Müller YM. Identification and evaluation of reference genes for expression studies by RT-qPCR during embryonic development of the emerging model organism, Macrobrachium olfersii. Gene. 2017 Jan 20;598:97-106. doi: 10.1016/j.gene.2016.11.001. Epub 2016 Nov 5. PubMed PMID: 27825774.
  2. Mendonça NN, Masui DC, McNamara JC, Leone FA, Furriel RP. Long-term exposure of the freshwater shrimp Macrobrachium olfersii to elevated salinity: effects on gill (Na+,K+)-ATPase alpha-subunit expression and K+-phosphatase activity. Comp Biochem Physiol A Mol Integr Physiol. 2007 Apr;146(4):534-43. Epub 2006 Mar 10. PubMed PMID: 16529963.