Difference between revisions of "Manihot esculenta"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Manihot esculenta-1.jpg|right|200px|link=Manihot esculenta]]
 
[[File:Manihot esculenta-1.jpg|right|200px|link=Manihot esculenta]]
* '''''Cassava (Manihot esculenta Crantz)''''' is a staple food crop in Africa, Latin America and Asia. It is a crop thriving in tropical and subtropical regions because of its starchy tuberous root, which is edible and a major source of carbohydrates <ref name="ref1"/><ref name="ref2"/>.
+
* '''''Cassava (Manihot esculenta Crantz)''''' is a staple food crop in Africa, Latin America and Asia. It is a crop thriving in tropical and subtropical regions because of its starchy tuberous root, which is edible and a major source of carbohydrates. Native to the New World tropics and a member of family Euphorbiaceae, cassava and some 90 other species make up the genus Manihot. Cassava is the only widely cultivated member, being valued for its starchy tuberous roots, which provides food or an export com- modity in nearly all tropical countries of the world <ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Cassava'''
 
* <font color=blue>'''Common Name:'''</font> '''Cassava'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3983&lvl=3&lin=f&keep=1&srchmode=1&unlock <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3983&lvl=3&lin=f&keep=1&srchmode=1&unlock <font color=blue>'''NCBI Taxonomy'''</font>]

Revision as of 06:20, 10 August 2017

Description

Manihot esculenta-1.jpg
  • Cassava (Manihot esculenta Crantz) is a staple food crop in Africa, Latin America and Asia. It is a crop thriving in tropical and subtropical regions because of its starchy tuberous root, which is edible and a major source of carbohydrates. Native to the New World tropics and a member of family Euphorbiaceae, cassava and some 90 other species make up the genus Manihot. Cassava is the only widely cultivated member, being valued for its starchy tuberous roots, which provides food or an export com- modity in nearly all tropical countries of the world [1][2].
  • Common Name: Cassava
  • NCBI Taxonomy

Different Tissues & Developmental Stages & Abiotic & Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
NPC-β[3] Nascent polypeptide-associated complex subunit beta
  • Major cassava samples
cassava4.1_017977
  • F:ATGGGTTGTTAGCGGCTCT
  • R:ATCTGCTCCGCCAACTTCT
114 NA SYBR
HD[3] Histidinol dehydrogenase
  • Major cassava samples
  • Normally grown samples
cassava4.1_006391
  • F:ATTATGCAAGCGGGACAAAC
  • R:ACTCCACCGTACATCCTTGC
64 NA SYBR
RPL[3] Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein
  • Drought stressed samples
cassava4.1_014335
  • F:GTTTGATGAGCACCGGAAG
  • R:TCTTGGCCTGAGACTTGGA
62 NA SYBR
26S[3] 26S proteasome regulatory complex, subunit N10
  • Drought stressed samples
cassava4.1_006884
  • F:AATGCGCTCCTACAACAAGC
  • R:GATCATCCGTAGCAGCCTCT
100 NA SYBR
PP2A[3] Serine/threonine-PP2A catalytic subunit
  • Normally grown samples
cassava4.1_012496
  • F:GCTTGTCATGGAAGGGTACAA
  • R:TTCCCACATCGGTAGCAATAG
86 NA SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Wenquan Wang
  • Email: wangwenquan@itbb.org.cn
  • Institute: College of Agriculture, Hainan University, Haikou, China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. Qin Y, Djabou AS, An F, Li K, Li Z, Yang L, Wang X, Chen S. Proteomic analysis of injured storage roots in cassava (Manihot esculenta Crantz) under postharvest physiological deterioration. PLoS One. 2017 Mar 24;12(3):e0174238. doi: 10.1371/journal.pone.0174238. eCollection 2017. PubMed PMID: 28339481; PubMed Central PMCID: PMC5365129.
  2. Bredeson JV, Lyons JB, Prochnik SE, Wu GA, Ha CM, Edsinger-Gonzales E, et al. (2016) Sequencing wild and cultivated cassava and related species reveals extensive interspecific hybridization and genetic diversity. Nat Biotechnol 34(5): 562–570. doi: 10.1038/nbt.3535
  3. 3.0 3.1 3.2 3.3 3.4 Hu, Meizhen, et al. "Validation of reference genes for relative quantitative gene expression studies in cassava (Manihot esculenta Crantz) by using quantitative real-time PCR." Frontiers in plant science 7 (2016).

Categories