Manihot esculenta

From ICG
Jump to navigation Jump to search

Description

Manihot esculenta-1.jpg

Cassava (Manihot esculenta Crantz) is a staple food crop in Africa, Latin America and Asia. However, the rapid post-harvest physiological deterioration (PPD), a unique phenomenon in harvesting storage roots, has become a major constraint for extending cassava shelf-life compared with other root crops. PPD is an active process involving in the changes of gene expression, novel protein synthesis and secondary metabolite accumulation. Undesirable vascular streaking developed quickly was observed in the harvest storage roots and then caused deterioration within 2-3d. Because of PPD phenomenon, cassava storage roots have to be consumed soon after harvest. [1][2].

Different Tissues & Developmental Stages & Abiotic & Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
NPC-β[3] Nascent polypeptide-associated complex subunit beta
  • Major cassava samples
cassava4.1_017977
  • F:ATGGGTTGTTAGCGGCTCT
  • R:ATCTGCTCCGCCAACTTCT
114 NA SYBR
HD[3] Histidinol dehydrogenase
  • Major cassava samples
  • Normally grown samples
cassava4.1_006391
  • F:ATTATGCAAGCGGGACAAAC
  • R:ACTCCACCGTACATCCTTGC
64 NA SYBR
RPL[3] Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein
  • Drought stressed samples
cassava4.1_014335
  • F:GTTTGATGAGCACCGGAAG
  • R:TCTTGGCCTGAGACTTGGA
62 NA SYBR
26S[3] 26S proteasome regulatory complex, subunit N10
  • Drought stressed samples
cassava4.1_006884
  • F:AATGCGCTCCTACAACAAGC
  • R:GATCATCCGTAGCAGCCTCT
100 NA SYBR
PP2A[3] Serine/threonine-PP2A catalytic subunit
  • Normally grown samples
cassava4.1_012496
  • F:GCTTGTCATGGAAGGGTACAA
  • R:TTCCCACATCGGTAGCAATAG
86 NA SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Wenquan Wang
  • Email: wangwenquan@itbb.org.cn
  • Institute: College of Agriculture, Hainan University, Haikou, China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. Qin Y, Djabou AS, An F, Li K, Li Z, Yang L, Wang X, Chen S. Proteomic analysis of injured storage roots in cassava (Manihot esculenta Crantz) under postharvest physiological deterioration. PLoS One. 2017 Mar 24;12(3):e0174238. doi: 10.1371/journal.pone.0174238. eCollection 2017. PubMed PMID: 28339481; PubMed Central PMCID: PMC5365129.
  2. Bredeson JV, Lyons JB, Prochnik SE, Wu GA, Ha CM, Edsinger-Gonzales E, et al. (2016) Sequencing wild and cultivated cassava and related species reveals extensive interspecific hybridization and genetic diversity. Nat Biotechnol 34(5): 562–570. doi: 10.1038/nbt.3535
  3. 3.0 3.1 3.2 3.3 3.4 Hu, Meizhen, et al. "Validation of reference genes for relative quantitative gene expression studies in cassava (Manihot esculenta Crantz) by using quantitative real-time PCR." Frontiers in plant science 7 (2016).

Categories