Difference between revisions of "Medicago sativa"

From ICG
Jump to navigation Jump to search
 
(15 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2015007-1.jpg|right|227px|]]
+
[[File:Medicago sativa.png|right|200px|link=Medicago sativa]]
* Cultivated alfalfa (Medicago sativa L.) is a major forage legume grown extensively worldwide. This perennial species has a tetraploid (2n = 4x = 32) genome which displays tetrasomic inheritance and its populations are extremely polymorphic due to a high degree of outcrossing. Superior tolerance to environmental stress and decline in stem digestibility during plant development are major issues for alfalfa breeding programs.  
+
*'''''Medicago sativa L.''''' is a major forage legume grown extensively worldwide. This perennial species has a tetraploid (2n = 4x = 32) genome which displays tetrasomic inheritance and its populations are extremely polymorphic due to a high degree of outcrossing. Superior tolerance to environmental stress and decline in stem digestibility during plant development are major issues for its breeding programs. Insufficient tolerance to subfreezing temperatures reduces long term persistence of alfalfa in northern countries and is a source of major costs associated with stands reestablishment and the need to buy forage outside the farm<ref name="ref1"/> <ref name="ref2"/>.
* Insufficient tolerance to subfreezing temperatures reduces long term persistence of alfalfa in northern countries and is a source of major costs associated with stands reestablishment and the need to buy forage outside the farm.Lignin deposition in maturing stems significantly interferes with the release of simple sugars from the cellulose and hemi-cellulose fiber fraction and causes a significant decline in feed value.
+
* <font color=blue>'''Common Name:'''</font> '''Lucerne''','''Cultivated alfalfa'''
* Alfalfa holds the distinction of being the oldest forage crop for which we have a name, yet the etymology of the word is uncertain. It may have arisen from modifications of the Persian aspo-asti (horse fodder), the Arabic al-fasfasa or the Kashmiri ashwa-bal (both meaning horse power). Some have speculated that the name most commonly used in Europe, "lucerne," may derive from the Persian word läjwärd for lapis lazuli, the ultramarine blue mineral lazurite, in reference to the blue flowers of Medicago sativa—one of the two species, with M. falcata, known as alfalfa. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3879 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Environmental & Developmental Regulation'''''==
 
=='''''Different Environmental & Developmental Regulation'''''==
===Reference Genes===
+
 
 +
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 21: Line 22:
 
|align="center"| Ubiquitin protein ligase 2a
 
|align="center"| Ubiquitin protein ligase 2a
 
|
 
|
* Universal reference gene
+
* Cold Acclimation Indoors
 +
* Cold Acclimation Outdoor
 +
* Water Stress and Photoperiod
 +
* Plant Development
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/JZ818487 '''JZ818487''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/JZ818487 '''JZ818487''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CCAAACCCAAACTCACCAG
 
* F:CCAAACCCAAACTCACCAG
* R:CCAAACCCAAACTCACCAG
+
* R:AGCAGTCCAACTCTGCTCAAC
 
|align="center"|  108  
 
|align="center"|  108  
 
|align="center"| 80.5
 
|align="center"| 80.5
Line 33: Line 37:
 
|align="center"| Actin depolymerizing factor
 
|align="center"| Actin depolymerizing factor
 
|
 
|
* Universal reference gene
+
* Cold Acclimation Indoors
 +
* Cold Acclimation Outdoor
 +
* Water Stress and Photoperiod
 +
* Plant Development
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/JZ818469 '''JZ818469''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/JZ818469 '''JZ818469''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCATCTGGTATGGCAGTCC
 
* F:GCATCTGGTATGGCAGTCC
* R:GCATCTGGTATGGCAGTCC
+
* R:GCACTCATCAGCAGGAAGG
 
|align="center"|  183  
 
|align="center"|  183  
 
|align="center"| 81.4
 
|align="center"| 81.4
Line 45: Line 52:
 
|align="center"| Retention in endoplasmic reticulum 1 protein
 
|align="center"| Retention in endoplasmic reticulum 1 protein
 
|
 
|
* Universal reference gene
+
* Cold Acclimation Indoors
 +
* Cold Acclimation Outdoor
 +
* Water Stress and Photoperiod
 +
* Plant Development
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/JZ818481 '''JZ818481''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/JZ818481 '''JZ818481''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCCTTCTGATGGTGGACCT
 
* F:GCCTTCTGATGGTGGACCT
* R:GCCTTCTGATGGTGGACCT
+
* R:GGCCAGAAGACAGGAACATC
 
|align="center"|  165  
 
|align="center"|  165  
 
|align="center"| 78.9
 
|align="center"| 78.9
Line 55: Line 65:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 64: Line 75:
 
*'''Institution''': Soils and Crops Research and Development Center, Agriculture and Agri-Food Canada, Québec, Canada
 
*'''Institution''': Soils and Crops Research and Development Center, Agriculture and Agri-Food Canada, Québec, Canada
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''5''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=8436328482923729395&as_sdt=2005&sciodt=0,5&hl=en'''6'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 77: Line 88:
 
</references>
 
</references>
  
[[Category:Plants]]
+
=='''Categories'''==
 +
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ADF]][[Category:Rer1]][[Category:Ubiquitin]][[Category:Different Environmental Conditions]] [[Category:Different Developmental Stages]][[Category:geNorm]]

Latest revision as of 07:09, 1 September 2017

Description

Medicago sativa.png
  • Medicago sativa L. is a major forage legume grown extensively worldwide. This perennial species has a tetraploid (2n = 4x = 32) genome which displays tetrasomic inheritance and its populations are extremely polymorphic due to a high degree of outcrossing. Superior tolerance to environmental stress and decline in stem digestibility during plant development are major issues for its breeding programs. Insufficient tolerance to subfreezing temperatures reduces long term persistence of alfalfa in northern countries and is a source of major costs associated with stands reestablishment and the need to buy forage outside the farm[1] [2].
  • Common Name: Lucerne,Cultivated alfalfa
  • NCBI Taxonomy

Different Environmental & Developmental Regulation

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBL-2a[1] Ubiquitin protein ligase 2a
  • Cold Acclimation Indoors
  • Cold Acclimation Outdoor
  • Water Stress and Photoperiod
  • Plant Development
JZ818487
  • F:CCAAACCCAAACTCACCAG
  • R:AGCAGTCCAACTCTGCTCAAC
108 80.5 SYBR
ADF[1] Actin depolymerizing factor
  • Cold Acclimation Indoors
  • Cold Acclimation Outdoor
  • Water Stress and Photoperiod
  • Plant Development
JZ818469
  • F:GCATCTGGTATGGCAGTCC
  • R:GCACTCATCAGCAGGAAGG
183 81.4 SYBR
Rer1[1] Retention in endoplasmic reticulum 1 protein
  • Cold Acclimation Indoors
  • Cold Acclimation Outdoor
  • Water Stress and Photoperiod
  • Plant Development
JZ818481
  • F:GCCTTCTGATGGTGGACCT
  • R:GGCCAGAAGACAGGAACATC
165 78.9 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yves Castonguay
  • Email: yves.castonguay@agr.gc.ca
  • Institution: Soils and Crops Research and Development Center, Agriculture and Agri-Food Canada, Québec, Canada

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Castonguay Y, Michaud J, Dubé M-P (2015) Reference Genes for RT-qPCR Analysis of Environmentally and Developmentally Regulated Gene Expression in Alfalfa. American Journal of Plant Sciences 06, 132-143.
  2. Russelle, M.P. (2001) Alfalfa. American Scientist, 89, 252-261. http://dx.doi.org/10.1511/2001.3.252

Categories