Difference between revisions of "Mus musculus"

From ICG
Jump to navigation Jump to search
Line 464: Line 464:
Cited by '''4''' (Based on Google Scholar [2017-06-16])
Cited by '''4''' (Based on Google Scholar [2017-06-16])
=='''Embryonic and Extra Embryonic Stem Cells'''==
=='''Embryonic & Embryonic Stem Cells'''==
===Reference Genes===
===Reference Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"

Revision as of 04:32, 20 June 2017


Dextran Sodium Sulfate Experimental Colitis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Tbp[1] TATA-box-binding protein
  • Mouse Dextran Sodium Sulfate Experimental Colitis
86 60.8~61.3 SYBR
Eef2[1] Eukaryotic Translation Elongation Factor 2
  • Mouse Dextran Sodium Sulfate Experimental Colitis
123 62.1~62.2 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Jean-Eric Ghia
  • Email: Jean-Eric.Ghia@umanitoba.ca
  • Institute: Immunology, University of Manitoba, Winnipeg, MB, Canada

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-06-16])

Mouse Mammary Glands

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
HPRT[2] hypoxanthine guanine phosphoribosyl transferase
  • Mammary glands
86 60 SYBR
RPL13A[2] ribosomal protein L13A
  • Mammary glands
168 60 SYBR
GAPDH[2] glyceraldehyde-3-phosphate dehydrogenase
  • Mammary glands
150 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Y.L. Wang
  • Email: ylwang2001@yahoo.cn
  • Institute: College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou, China

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-06-16])

Mouse Uterus in the Peri-Implantation Period

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPLP0[3] Ribosomal protein, large, P0
  • Early pregnancy, pseudopregnancy, delayed implantation
  • Activation, artificial decidualization
  • Hormonal treatment model
85 60 SYBR
GAPDH[3] Glyceraldehydes-3-phosphate dehydrogenase
  • Early pregnancy, pseudopregnancy, delayed implantation
  • Activation, artificial decidualization
  • Hormonal treatment model
186 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: AiHua Wang
  • Email: pflin2001n@163.com
  • Institute: College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi, China

Citation Statistics

Cited by 28 (Based on Google Scholar [2017-06-16])

Different Tissues & Ageing

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Rpl13a[4] ribosomal protein L13a
  • Cerebral cortex during ageing
  • Cortex during ageing
  • Hippocampus during ageing
  • F:tacgctgtgaaggcatcaac
  • R:gggaggggttggtattcatc
96 60 SYBR
GAPDH[4] glyceraldehyde-3-phosphate dehydrogenase
  • Cerebral cortex during ageing
  • Cortex during ageing
  • Cerebellum during ageing
  • F:tgcgacttcaacagcaactc
  • R:atgtaggcaatgaggtccac
143 60 SYBR
Ppib[4] peptidylprolyl isomerase B
  • Striatum during ageing
  • Cerebellum during ageing
  • F:cagcaagttccatcgtgtca
  • R:gatgctctttcctcctgtgc
85 60 SYBR
Hprt[4] hypoxanthine guanine phosphoribosyl transferase
  • Hippocampus during ageing
  • Cerebellum during ageing
  • F:ctttgctgacctgctggatt
  • R:tatgtcccccgttgactgat
121 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: B.D.Roussel
  • Email: broussel@cyceron.fr
  • Institute: INSERM, INSERM U919, Serine Proteases and Pathophysiology of the Neurovascular Unit, GIP CYCERON, University Caen Basse Normandie, boulevard Becquerel, 14074 Caen, France

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-16])

Lung Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Tuba1a[5] alpha 1a tubulin
  • During different stages of lung development
227 60.39~61.43 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Guillermo Barreto
  • Email: guillermo.barreto@mpi-bn.mpg.de
  • Institute: LOEWE Research Group Lung Cancer Epigenetic, Max-Planck-Institute for Heart and Lung Research, Parkstraße 1, 61231 Bad Nauheim, Germany

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-16])

Epithelial and Nonepithelial Cells of Small Intestine

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GUSB[6] Beta-glucuronidase
  • Mouse small intestine
197 55–60 SYBR
TBP[6] TATAA-box binding protein
  • Mouse small intestine
131 55–60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Yongping Su
  • Email: suyp2003@yahoo.com.cn
  • Institute: Institute of Combined Injury, State Key Laboratory of Trauma, Burns and Combined Injury, College of Preventive Medicine, Third Military Medical University, 30 Gaotanyan Road, Shapingba District, Chongqing 400038, China

Citation Statistics

Cited by 52 (Based on Google Scholar [2017-06-16])

Preimplantation Embryos

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
h2afz[7] H2A histone family, member Z
  • B6D2F-1 and C57BL/6 strains
  • Blastocyst embryonic stages cultured in KSOM medium
  • KOSOM and CZB cultures of B6D2F-1 and C57BL/6 strain-derived embryos
  • Zygote stage embryos
  • 2-cell, 4-cell, 8-cell stage embryos cultured in M16 medium
89 60 SYBR
sptbn[7] pectrin beta, non-erythrocytic 1
  • ICR strain-derived embryos
101 55 SYBR
wrnip[7] Werner helicase interacting protein 1
  • M16 culture of B6D2F-1
  • C57BL/6 strain-derived embryos
  • 2-cell, 4-cell stage embryos cultured in CZB medium
  • Blastocyst stage embryos cultured in M16 medium
130 56 SYBR
ywhaz[7] ywhaz
  • Zygote & molular embryonic stages cultured in KSOM medium
  • Molular stage embryos cultured in CZB medium
92 60 SYBR
tgfb1[7] transforming growth factor, beta 1
  • 2-cell embryonic stages cultured in KSOM medium
83 55 SYBR
18s[7] 18S rRNA
  • 4-cell, 8-cell embryonic stages cultured in KSOM medium
  • Zygote embryos cultured in M16 medium
102 60 SYBR
actb[7] actin, beta
  • 8-cell stage embryos cultured in M16 medium
98 56 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Jin-Hoi Kim
  • Email: jhkim541@konkuk.ac.kr
  • Institute: Department of Animal Biotechnology, KonKuk University, Seoul 143-701, Republic of Korea

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-16])

Embryonic & Embryonic Stem Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Pgk1[8] phosphoglycerate kinase 1
  • Between ES, TS and XEN stem cells
  • The in vitro differentiation of embryonic and trophectoderm stem cells
110 60 SYBR
Sdha[8] Succinate dehydrogenase complex, subunit A
  • Between ES, TS and XEN stem cells
  • The in vitro differentiation of embryonic and trophectoderm stem cells
134 60 SYBR
Tbp[8] TATA box binding protein
  • Between ES, TS and XEN stem cells
  • The in vitro differentiation of embryonic and trophectoderm stem cells
127 60 SYBR
Ywhaz[8] Tyrosine 3-monooxygenase /tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • The in vitro differentiation of embryonic and trophectoderm stem cells
88 60 SYBR
Hk2[8] hexokinase 2
  • The in vitro differentiation of embryonic and trophectoderm stem cells
251 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Michael C. Golding
  • Email: mgolding@cvm.tamu.edu
  • Institute: College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas, United States of America

Citation Statistics

Cited by 41 (Based on Google Scholar [2017-06-16])

Mouse Model of Obesity

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[9] Beta 2 Microglobulin
  • Liver of monosodium glutamate (MSG)-injected mice with developed central obesity
103 83.5 SYBR
18S[9] 18S Ribosomal RNA
  • Liver of monosodium glutamate (MSG)-injected mice with developed central obesity
  • Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
133 85 SYBR
HPRT1[9] Hypoxanthine phosphoribosyl transferase
  • Liver of monosodium glutamate (MSG)-injected mice with developed central obesity
  • Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
167 81.5 SYBR
RPlP0[9] Ribosomal Protein large P0
  • Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
136 87.5 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Petra Matoušková
  • Email: matousp7@faf.cuni.cz
  • Institute: Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-06-16])

Testis Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Ppia[10] peptidylprolyl isomerase A
  • Testis development
144 60 SYBR
Gapdh[10] glyceraldehyde-3-phosphate dehydrogenase
  • Testis development
150 60 SYBR
Actb[10] beta actin
  • Testis development
171 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Wen Zhen Lin
  • Email: linwenzhen@msn.com
  • Institute: Department of Biochemistry and Molecular Biology, School of Preclinical Sciences, Guangxi Medical University, Nanning 530021, Guangxi, China

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-06-16])

Intestinal Epithelial Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Ppib[11] Peptidylprolyl isomerase B
  • Univeral reference gene in the differentiated fraction
156 60 SYBR
Ppia[11] Peptidyl-prolyl cis–trans isomerase A
  • Proliferating intestinal compartments and IEC6 cells
109 60 SYBR
Gapdh[11] Glyceraldehyde-3-phosphate dehydrogenase
  • Univeral reference gene in the differentiated fraction
152 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Maria Sirakov
  • Email: maria.sirakov@ulb.ac.be
  • Institute: Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies, Belgium

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-16])

Mouse Skeletal Muscle

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Rpl27[12] ribosomal protein L27
  • R129 strain
143 65 SYBR
Rer1[12] Retention in endoplasmic reticulum 1 protein
  • R129 strain & C57BL/6j strain & C57BL/10 strain
137 62 SYBR
Rpl41[12] ribosomal protein L41
  • R129 strain and Rpl7l1
  • C57BL/6j
113 65 SYBR
Rpl7l1[12] ribosomal protein L7-like 1
  • C57BL/6j strain & C57BL/10 strain
110 65 SYBR
Aldoa[12] aldolase A, fructose-bisphosphate
  • C57BL/10 strain
136 62 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Kathryn N. North
  • Email: Kathryn.north@mcri.edu.au
  • Institute: Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-06-16])


  1. 1.0 1.1 Eissa N, Hussein H, Wang H, et al. Stability of Reference Genes for Messenger RNA Quantification by Real-Time PCR in Mouse Dextran Sodium Sulfate Experimental Colitis[J]. PloS one, 2016, 11(5): e0156289.
  2. 2.0 2.1 2.2 Han L Q, Yang G Y, Zhu H S, et al. Selection and use of reference genes in mouse mammary glands[J]. Genet Mol Res, 2010, 9(1): 449-56.
  3. 3.0 3.1 Lin P F, Lan X L, Chen F L, et al. Reference gene selection for real-time quantitative PCR analysis of the mouse uterus in the peri-implantation period[J]. PloS one, 2013, 8(4): e62462.
  4. 4.0 4.1 4.2 4.3 Bruckert G, Vivien D, Docagne F, et al. Normalization of Reverse Transcription Quantitative PCR Data During Ageing in Distinct Cerebral Structures[J]. Molecular neurobiology, 2016, 53(3): 1540-1550.
  5. Mehta A, Dobersch S, Dammann R H, et al. Validation of Tuba1a as appropriate internal control for normalization of gene expression analysis during mouse lung development[J]. International journal of molecular sciences, 2015, 16(3): 4492-4511.
  6. 6.0 6.1 Wang F, Wang J, Liu D, et al. Normalizing genes for real-time polymerase chain reaction in epithelial and nonepithelial cells of mouse small intestine[J]. Analytical biochemistry, 2010, 399(2): 211-217.
  7. 7.0 7.1 7.2 7.3 7.4 7.5 7.6 Jeong J K, Kang M H, Gurunathan S, et al. Evaluation of reference genes in mouse preimplantation embryos for gene expression studies using real-time quantitative RT-PCR (RT-qPCR)[J]. BMC research notes, 2014, 7(1): 675.
  8. 8.0 8.1 8.2 8.3 8.4 Veazey K J, Golding M C. Selection of stable reference genes for quantitative rt-PCR comparisons of mouse embryonic and extra-embryonic stem cells[J]. PloS one, 2011, 6(11): e27592.
  9. 9.0 9.1 9.2 9.3 Matoušková P, Bártíková H, Boušová I, et al. Reference genes for real-time PCR quantification of messenger RNAs and microRNAs in mouse model of obesity[J]. PLoS One, 2014, 9(1): e86033.
  10. 10.0 10.1 10.2 Gong Z K, Wang S J, Huang Y Q, et al. Identification and validation of suitable reference genes for RT-qPCR analysis in mouse testis development[J]. Molecular genetics and genomics, 2014, 289(6): 1157-1169.
  11. 11.0 11.1 11.2 Sirakov M, Borra M, Cambuli F M, et al. Defining suitable reference genes for RT-qPCR analysis on intestinal epithelial cells[J]. Molecular biotechnology, 2013, 54(3): 930-938.
  12. 12.0 12.1 12.2 12.3 12.4 Thomas K C, Zheng X F, Suarez F G, et al. Evidence based selection of commonly used RT-qPCR reference genes for the analysis of mouse skeletal muscle[J]. PloS one, 2014, 9(2): e88653.