Difference between revisions of "Mus musculus"

Latest revision as of 07:41, 7 September 2017

1 Description
2 Dextran Sodium Sulfate Experimental Colitis
3 Mammary Glands
4 Uterus in the Peri-Implantation Period
5 Different Tissues & Ageing
6 Lung Development
7 Epithelial & Nonepithelial Cells
8 Preimplantation Embryos
9 Embryonic Stem Cells
10 Obesity Model
11 Testis Development
12 Intestinal Epithelial Cells
13 Skeletal Muscle & Different Genotypes
14 References
15 Categories

Description

Mus musculus is a small mammal of the order Rodentia, characteristically having a pointed snout, small rounded ears, and a long naked or almost hairless tail. It is one of the most numerous species of the genus Mus. Although a wild animal, the house mouse mainly lives in association with humans (Modified from Wikipedia).
Common Name: Mouse
NCBI Taxonomy

Dextran Sodium Sulfate Experimental Colitis

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Tbp^[1]	TATA-box-binding protein	Mouse dextran sodium sulfate experimental colitis	NM_013684	F:ACCGTGAATCTTGGCTGTAAAC R:GCAGCAAATCGCTTGGGATTA	86	60.8~61.3	SYBR
Eef2^[1]	Eukaryotic Translation Elongation Factor 2	Mouse dextran sodium sulfate experimental colitis	NM_007907.2	F:TGTCAGTCATCGCCCATGTG R:CATCCTTGCGAGTGTCAGTGA	123	62.1~62.2	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: Jean-Eric Ghia
Email: Jean-Eric.Ghia@umanitoba.ca
Institution: Immunology, University of Manitoba, Winnipeg, MB, Canada

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-09-01])

Mammary Glands

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
HPRT^[2]	Hypoxanthine guanine phosphoribosyl transferase	Mouse mammary glands	NM_013556	F:CCTAAGATGAGCGCAAGTTGAA R:CCACAGGACTAGAACACCTGCTAA	86	60	SYBR
RPL13A^[2]	Ribosomal protein L13A	Mouse mammary glands	NM_009438	F:CCTAAGATGAGCGCAAGTTGAA R:CCACAGGACTAGAACACCTGCTAA	168	60	SYBR
GAPDH^[2]	Glyceraldehyde-3-phosphate dehydrogenase	Mouse mammary glands	NM_008084	F:TGTGTCCGTCGTGGATCTGA R:TTGCTGTTGAAGTCGCAGGAG	150	60	SYBR

Molecular Types

mRNA

Evaluation Methods

geNorm method && Related Reference

Contact

Name: Y.L. Wang
Email: ylwang2001@yahoo.cn
Institution: College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou, China

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-09-01])

Uterus in the Peri-Implantation Period

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
RPLP0^[3]	Ribosomal protein, large, P0	Early pregnancy, pseudopregnancy, delayed implantation Activation, artificial decidualization Hormonal treatment model	NM_007475	F:GGACCCGAGAAGACCTCCTT R:GCACATCACTCAGAATTTCAATGG	85	60	SYBR
GAPDH^[3]	Glyceraldehydes-3-phosphate dehydrogenase	Early pregnancy, pseudopregnancy, delayed implantation Activation, artificial decidualization Hormonal treatment model	NM_008084	F:TCACTGCCACCCAGAAGA R:GACGGACACATTGGGGGTAG	186	60	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: AiHua Wang
Email: pflin2001n@163.com
Institution: College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi, China

Citation Statistics

Cited by 28 (Based on Google Scholar [2017-09-01])

Different Tissues & Ageing

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Rpl13a^[4]	Ribosomal protein L13a	Cerebral cortex during ageing Cortex during ageing Hippocampus during ageing	NM_009438.5	F:TACGCTGTGAAGGCATCAAC R:GGGAGGGGTTGGTATTCATC	96	60	SYBR
GAPDH^[4]	Glyceraldehyde-3-phosphate dehydrogenase	Cerebral cortex during ageing Cortex during ageing Cerebellum during ageing	NM_008084.3	F:TGCGACTTCAACAGCAACTC R:ATGTAGGCAATGAGGTCCAC	143	60	SYBR
Ppib^[4]	Peptidylprolyl isomerase (Cyclophilin) B	Striatum during ageing Cerebellum during ageing	NM_011149.2	F:CAGCAAGTTCCATCGTGTCA R:GATGCTCTTTCCTCCTGTGC	85	60	SYBR
Hprt^[4]	Hypoxanthine guanine phosphoribosyl transferase	Hippocampus during ageing Cerebellum during ageing	NM_013556.2	F:CTTTGCTGACCTGCTGGATT R:TATGTCCCCCGTTGACTGAT	121	60	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: B.D.Roussel
Email: broussel@cyceron.fr
Institution: INSERM, INSERM U919, Serine Proteases and Pathophysiology of the Neurovascular Unit, GIP CYCERON, University Caen Basse Normandie, boulevard Becquerel, 14074 Caen, France

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

Lung Development

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Tuba1a^[5]	Alpha 1a tubulin	Different stages of lung development	NM_011653	F:CCGCGAAGCAGCAACCAT R:CCAGGTCTACGAACACTGCC	227	60.39~61.43	SYBR

Molecular Types

mRNA

Evaluation Methods

geNorm method && Related Reference

Contact

Name: Guillermo Barreto
Email: guillermo.barreto@mpi-bn.mpg.de
Institution: LOEWE Research Group Lung Cancer Epigenetic, Max-Planck-Institute for Heart and Lung Research, Parkstraße 1, 61231 Bad Nauheim, Germany

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

Epithelial & Nonepithelial Cells

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
GUSB^[6]	Beta-glucuronidase	Eepithelial cells isolated from the mouse intestine Eepithelial cells isolated the IEC6 cell line	NM_010368	F:CCGATTATCCAGAGCGAGTATG R:CTCAGCGGTGACTGGTTCG	197	55–60	SYBR
TBP^[6]	TATA-box binding protein	Eepithelial cells isolated from the mouse intestine Eepithelial cells isolated the IEC6 cell line	NM_008907	F:CAAACCCAGAATTGTTCTCCTT R:ATGTGGTCTTCCTGAATCCCT	131	55–60	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: Yongping Su
Email: suyp2003@yahoo.com.cn
Institution: Institute of Combined Injury, State Key Laboratory of Trauma, Burns and Combined Injury, College of Preventive Medicine, Third Military Medical University, 30 Gaotanyan Road, Shapingba District, Chongqing 400038, China

Citation Statistics

Cited by 55 (Based on Google Scholar [2017-09-01])

Preimplantation Embryos

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
h2afz^[7]	H2A histone family, member Z	B6D2F-1 and C57BL/6 strains Blastocyst embryonic stages cultured in KSOM medium KOSOM and CZB cultures of B6D2F-1 and C57BL/6 strain-derived embryos Zygote stage embryos 2-cell, 4-cell, 8-cell stage embryos cultured in M16 medium	NM_016750	F:GTGGACTGTATCTCTGTGAA R:GGTTGGTTGGAAGGCTAA	89	60	SYBR
sptbn^[7]	Pectrin beta, non-erythrocytic 1	ICR strain-derived embryos	NM_175836	F:TCTAATGGTTACTTGCTTGT R:CAATAGTTACAGTGACAGAGA	101	55	SYBR
wrnip^[7]	Werner helicase interacting protein 1	M16 culture of B6D2F-1 C57BL/6 strain-derived embryos 2-cell, 4-cell stage embryos cultured in CZB medium Blastocyst stage embryos cultured in M16 medium	NM_030215	F:ATGAGTAGGATGCTTGTA R:TAACCACCTCCATCTATG	130	56	SYBR
ywhaz^[7]	14-3-3 protein zeta/delta (14-3-3ζ)	Zygote & molular embryonic stages cultured in KSOM medium Molular stage embryos cultured in CZB medium	NM_001253807	F:CAGTAGATGGAGAAAGATTTGC R:GGGACAATTAGGGAAGTAAGT	92	60	SYBR
tgfb1^[7]	Transforming growth factor, beta 1	2-cell embryonic stages cultured in KSOM medium	NM_011577	F:TATACTGAGACACCTTGG R:GTGATAGTCCTGAATAATTTG	83	55	SYBR
18s^[7]	18S rRNA	4-cell, 8-cell embryonic stages cultured in KSOM medium Zygote embryos cultured in M16 medium	X00686	F:CGCCGCTAGAGGTGAAATTCT R:CGAACCTCCGACTTTCGTTCT	102	60	SYBR
actb^[7]	β-actin	8-cell stage embryos cultured in M16 medium	NM_007393	F:ATCTTCCGCCTTAATACT R:GCCTTCATACATCAAGTT	98	56	SYBR

Molecular Types

mRNA

Evaluation Methods

NormFinder method && Related Reference

Contact

Name: Jin-Hoi Kim
Email: jhkim541@konkuk.ac.kr
Institution: Department of Animal Biotechnology, KonKuk University, Seoul 143-701, Republic of Korea

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

Embryonic Stem Cells

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Pgk1^[8]	Phosphoglycerate kinase 1	ES, TS and XEN stem cells In vitro differentiation of embryonic and trophectoderm stem cells	NM_008828	F:CTGACTTTGGACAAGCTGGACG R:GCAGCCTTGATCCTTTGGTTG	110	60	SYBR
Sdha^[8]	Succinate dehydrogenase complex, subunit A	ES, TS and XEN stem cells In vitro differentiation of embryonic and trophectoderm stem cells	BC011301	F:GCTCCTGCCTCTGTGGTTGA R:AGCAACACCGATGAGCCTG	134	60	SYBR
Tbp^[8]	TATA box binding protein	ES, TS and XEN stem cells In vitro differentiation of embryonic and trophectoderm stem cells	NM_013684	F:GAAGAACAATCCAGACTAGCAGCA R:CCTTATAGGGAACTTCACATCACAG	127	60	SYBR
Ywhaz^[8]	Tyrosine 3-monooxygenase /tryptophan 5-monooxygenase activation protein, zeta polypeptide	In vitro differentiation of embryonic and trophectoderm stem cells	NM_013684	F:TTGATCCCCAATGCTTCGC R:CAGCAACCTCGGCCAAGTAA	88	60	SYBR
Hk2^[8]	Hexokinase 2	In vitro differentiation of embryonic and trophectoderm stem cells	NM_011740	F:CCCTGTGAAGATGTTGCCCAC R:TGCCCATGTACTCAAGGAAGT	251	60	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: Michael C. Golding
Email: mgolding@cvm.tamu.edu
Institution: College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas, United States of America

Citation Statistics

Cited by 42 (Based on Google Scholar [2017-09-01])

Obesity Model

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
B2M^[9]	Beta 2 Microglobulin	Liver of monosodium glutamate (MSG)-injected mice with developed central obesity	NM_009735	F:GGTCTTTCTGGTGCTTGTCTCA R:GTTCGGCTTCCCATTCTCC	103	83.5	SYBR
18S^[9]	18S Ribosomal RNA	Liver of monosodium glutamate (MSG)-injected mice with developed central obesity Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity	NR_003278	F:GGCCGTTCTTAGTTGGTGGAGCG R:CTGAACGCCACTTGTCCCTC	133	85	SYBR
HPRT1^[9]	Hypoxanthine phosphoribosyl transferase	Liver of monosodium glutamate (MSG)-injected mice with developed central obesity Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity	NM_013556	F:CAGTCCCAGCGTCGTGATTA R:GGCCTCCCATCTCCTTCATG	167	81.5	SYBR
RPlP0^[9]	Ribosomal Protein large P0	Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity	NM_007475	F:GATGGGCAACTGTACCTGACTG R:CTGGGCTCCTCTTGGAATG	136	87.5	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: Petra Matoušková
Email: matousp7@faf.cuni.cz
Institution: Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic

Citation Statistics

Cited by 26 (Based on Google Scholar [2017-09-01])

Testis Development

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Ppia^[10]	Peptidylprolyl isomerase (Cyclophilin) A	Testis development	NM_008907	F:TGTGCCAGGGTGGTGACTT R:CGTTTGTGTTTGGTCCAGCAT	144	60	SYBR
Gapdh^[10]	Glyceraldehyde-3-phosphate dehydrogenase	Testis development	NM_008084	F:TGTGTCCGTCGTGGATCTGA R:TTGCTGTTGAAGTCGCAGGAG	150	60	SYBR
Actb^[10]	β-Actin	Testis development	NM_007393	F:CATCCGTAAAGACCTCTATGCCAAC R:ATGGAGCCACCGATCCACA	171	60	SYBR

Molecular Types

mRNA

Evaluation Methods

geNorm method && Related Reference
NormFinder method && Related Reference
Comparative ΔCt method && Related Reference
BestKeeper method && Related Reference
Ref-Finder method && Related Reference

Contact

Name: Wen Zhen Lin
Email: linwenzhen@msn.com
Institution: Department of Biochemistry and Molecular Biology, School of Preclinical Sciences, Guangxi Medical University, Nanning 530021, Guangxi, China

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Intestinal Epithelial Cells

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Ppib^[11]	Peptidylprolyl isomerase (Cyclophilin) B	Univeral reference gene in the differentiated fraction	NM_011149.2	F:CACCAATGGCTCACAGTTCTT R:ATGACATCCTTCAGTGGCTTG	156	60	SYBR
Ppia^[11]	Peptidyl-prolyl cis–trans isomerase (Cyclophilin) A	Proliferating intestinal compartments and IEC6 cells	NM_008907.1	F:CCACTGTCGCTTTTCGCCGC R:TGCAAACAGCTCGAAGGAGACGC	109	60	SYBR
Gapdh^[11]	Glyceraldehyde-3-phosphate dehydrogenase	Univeral reference gene in the differentiated fraction	XM_003945995.1	F:AGCAAGGACACTGAGCAAGAG R:AGCAAGGACACTGAGCAAGAG	152	60	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: Maria Sirakov
Email: maria.sirakov@ulb.ac.be
Institution: Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies, Belgium

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

Skeletal Muscle & Different Genotypes

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Rpl27^[12]	Ribosomal protein L27	R129 strain	NM_011289	F:AAGCCGTCATCGTGAAGAACA R:CTTGATCTTGGATCGCTTGGC	143	65	SYBR
Rer1^[12]	Retention in endoplasmic reticulum 1 protein	R129 strain C57BL/6j strain C57BL/10 strain	NM_026395	F:GCCTTGGGAATTTACCACCT R:CTTCGAATGAAGGGACGAAA	137	62	SYBR
Rpl41^[12]	Ribosomal protein L41	R129 strain and Rpl7l1 C57BL/6j strain	NM_018860	F:GCCATGAGAGCGAAGTGG R:CTCCTGCAGGCGTCGTAG	113	65	SYBR
Rpl7l1^[12]	Ribosomal protein L7-like 1	C57BL/6j strain C57BL/10 strain	NM_025433	F:ACGGTGGAGCCTTATGTGAC R:TCCGTCAGAGGGACTGTCTT	110	65	SYBR
Aldoa^[12]	Aldolase A, fructose-bisphosphate	C57BL/10 strain	NM_001177307	F:ACATTGCTGAAGCCCAACAT R:ACAGGAAAGTGACCCCAGTG	136	62	SYBR

Molecular Types

mRNA

Evaluation Methods

Ref-Finder method && Related Reference

Contact

Name: Kathryn N. North
Email: Kathryn.north@mcri.edu.au
Institution: Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-09-01])

References

↑ ^1.0 ^1.1 Eissa N, Hussein H, Wang H, et al. Stability of Reference Genes for Messenger RNA Quantification by Real-Time PCR in Mouse Dextran Sodium Sulfate Experimental Colitis[J]. PloS one, 2016, 11(5): e0156289.
↑ ^2.0 ^2.1 ^2.2 Han L Q, Yang G Y, Zhu H S, et al. Selection and use of reference genes in mouse mammary glands[J]. Genet Mol Res, 2010, 9(1): 449-56.
↑ ^3.0 ^3.1 Lin P F, Lan X L, Chen F L, et al. Reference gene selection for real-time quantitative PCR analysis of the mouse uterus in the peri-implantation period[J]. PloS one, 2013, 8(4): e62462.
↑ ^4.0 ^4.1 ^4.2 ^4.3 Bruckert G, Vivien D, Docagne F, et al. Normalization of Reverse Transcription Quantitative PCR Data During Ageing in Distinct Cerebral Structures[J]. Molecular neurobiology, 2016, 53(3): 1540-1550.
↑ Mehta A, Dobersch S, Dammann R H, et al. Validation of Tuba1a as appropriate internal control for normalization of gene expression analysis during mouse lung development[J]. International journal of molecular sciences, 2015, 16(3): 4492-4511.
↑ ^6.0 ^6.1 Wang F, Wang J, Liu D, et al. Normalizing genes for real-time polymerase chain reaction in epithelial and nonepithelial cells of mouse small intestine[J]. Analytical biochemistry, 2010, 399(2): 211-217.
↑ ^7.0 ^7.1 ^7.2 ^7.3 ^7.4 ^7.5 ^7.6 Jeong J K, Kang M H, Gurunathan S, et al. Evaluation of reference genes in mouse preimplantation embryos for gene expression studies using real-time quantitative RT-PCR (RT-qPCR)[J]. BMC research notes, 2014, 7(1): 675.
↑ ^8.0 ^8.1 ^8.2 ^8.3 ^8.4 Veazey K J, Golding M C. Selection of stable reference genes for quantitative rt-PCR comparisons of mouse embryonic and extra-embryonic stem cells[J]. PloS one, 2011, 6(11): e27592.
↑ ^9.0 ^9.1 ^9.2 ^9.3 Matoušková P, Bártíková H, Boušová I, et al. Reference genes for real-time PCR quantification of messenger RNAs and microRNAs in mouse model of obesity[J]. PLoS One, 2014, 9(1): e86033.
↑ ^10.0 ^10.1 ^10.2 Gong Z K, Wang S J, Huang Y Q, et al. Identification and validation of suitable reference genes for RT-qPCR analysis in mouse testis development[J]. Molecular genetics and genomics, 2014, 289(6): 1157-1169.
↑ ^11.0 ^11.1 ^11.2 Sirakov M, Borra M, Cambuli F M, et al. Defining suitable reference genes for RT-qPCR analysis on intestinal epithelial cells[J]. Molecular biotechnology, 2013, 54(3): 930-938.
↑ ^12.0 ^12.1 ^12.2 ^12.3 ^12.4 Thomas K C, Zheng X F, Suarez F G, et al. Evidence based selection of commonly used RT-qPCR reference genes for the analysis of mouse skeletal muscle[J]. PloS one, 2014, 9(2): e88653.

@@ Line 1: / Line 1: @@
-=='''Mouse Dextran Sodium Sulfate Experimental Colitis'''==
+=='''Description'''==
+[[File:Mus musculus.png|right|200px|link=Mus musculus]]
+* '''''Mus musculus''''' is a small mammal of the order Rodentia, characteristically having a pointed snout, small rounded ears, and a long naked or almost hairless tail. It is one of the most numerous species of the genus Mus. Although a wild animal, the house mouse mainly lives in association with humans [https://en.wikipedia.org/wiki/House_mouse (Modified from Wikipedia)].
+* <font color=blue>'''Common Name:'''</font> '''Mouse'''
+* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10090 <font color=blue>'''NCBI Taxonomy'''</font>]
-===Reference Genes===
+=='''''Dextran Sodium Sulfate Experimental Colitis'''''==
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 16: / Line 22: @@
 |align="center"| TATA-box-binding protein
 |
-*Mouse Dextran Sodium Sulfate Experimental Colitis
+*Mouse dextran sodium sulfate experimental colitis
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/172073170 '''NM_013684 ''']
 |nowrap style="font-size:9pt"|
@@ Line 28: / Line 34: @@
 |align="center"| Eukaryotic Translation Elongation Factor 2
 |
-*Mouse Dextran Sodium Sulfate Experimental Colitis
+*Mouse dextran sodium sulfate experimental colitis
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_007907.2 '''NM_007907.2''']
 |nowrap style="font-size:9pt"|
@@ Line 38: / Line 44: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 48: / Line 54: @@
 *'''Name''': Jean-Eric Ghia
 *'''Email''': Jean-Eric.Ghia@umanitoba.ca
-*'''Institute''': Immunology, University of Manitoba, Winnipeg, MB, Canada
+*'''Institution''': Immunology, University of Manitoba, Winnipeg, MB, Canada
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=15094739600394943508&as_sdt=2005&sciodt=0,5&hl=en '''3''' ](Based on Google Scholar [2017-09-01])
-=='''Mouse Mammary Glands'''==
+=='''''Mammary Glands'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt;width:100%;"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 64: / Line 72: @@
 |-
 |align="center"| HPRT<ref name="ref2"/>
-|align="center"| hypoxanthine guanine phosphoribosyl transferase
+|align="center"| Hypoxanthine guanine phosphoribosyl transferase
 |
-* Mammary glands
+* Mouse mammary glands
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013556 '''NM_013556''']
 |nowrap style="font-size:9pt"|
@@ Line 76: / Line 84: @@
 |-
 |align="center"| RPL13A<ref name="ref2"/>
-|align="center"| ribosomal protein L13A
+|align="center"| Ribosomal protein L13A
 |
-* Mammary glands
+* Mouse mammary glands
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_009438 '''NM_009438''']
 |nowrap style="font-size:9pt"|
@@ Line 88: / Line 96: @@
 |-
 |align="center"| GAPDH<ref name="ref2"/>
-|align="center"| glyceraldehyde-3-phosphate dehydrogenase
+|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 |
-* Mammary glands
+* Mouse mammary glands
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008084 '''NM_008084''']
 |nowrap style="font-size:9pt"|
@@ Line 100: / Line 108: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 109: / Line 117: @@
 *'''Name''': Y.L. Wang
 *'''Email''': ylwang2001@yahoo.cn
-*'''Institute''': College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou, China
+*'''Institution''': College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou, China
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=3139211935715979100&as_sdt=2005&sciodt=0,5&hl=en '''11'''] (Based on Google Scholar [2017-09-01])
-=='''Mouse Uterus in the Peri-Implantation Period'''==
+=='''''Uterus in the Peri-Implantation Period'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 127: / Line 137: @@
 |align="center"| Ribosomal protein, large, P0
 |
-* early pregnancy,  pseudopregnancy,  delayed implantation
+* Early pregnancy,  pseudopregnancy,  delayed implantation
-* activation,  artificial decidualization
+* Activation,  artificial decidualization
-* hormonal treatment model
+* Hormonal treatment model
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_007475 '''NM_007475''']
 |nowrap style="font-size:9pt"|
@@ Line 141: / Line 151: @@
 |align="center"| Glyceraldehydes-3-phosphate dehydrogenase
 |
-* early pregnancy,  pseudopregnancy,  delayed implantation
+* Early pregnancy,  pseudopregnancy,  delayed implantation
-* activation,  artificial decidualization
+* Activation,  artificial decidualization
-* hormonal treatment model
+* Hormonal treatment model
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008084 '''NM_008084''']
 |nowrap style="font-size:9pt"|
@@ Line 153: / Line 163: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 164: / Line 174: @@
 *'''Name''': AiHua Wang
 *'''Email''': pflin2001n@163.com
-*'''Institute''': College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi, China
+*'''Institution''': College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi, China
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=1151953663364672682&as_sdt=2005&sciodt=0,5&hl=en '''28''']  (Based on Google Scholar [2017-09-01])
-=='''During Ageing in Distinct Cerebral Structures'''==
+=='''''Different Tissues & Ageing'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! style="width=20%　font-size:9pt　"| Gene name
+! style="width=20%　font-size:9pt　"| Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 180: / Line 192: @@
 |-
 |align="center"| Rpl13a<ref name="ref4"/>
-|align="center"| ribosomal protein L13a
+|align="center"| Ribosomal protein L13a
 |
-* cerebral cortex during ageing
+* Cerebral cortex during ageing
-*cortex during ageing
+*Cortex during ageing
-*hippocampus during ageing
+*Hippocampus during ageing
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_009438.5 '''NM_009438.5''']
 |nowrap style="font-size:9pt"|
-* F:tacgctgtgaaggcatcaac
+* F:TACGCTGTGAAGGCATCAAC
-* R:gggaggggttggtattcatc
+* R:GGGAGGGGTTGGTATTCATC
 |align="center"| 96
 |align="center"| 60
@@ Line 194: / Line 206: @@
 |-
 |align="center"| GAPDH<ref name="ref4"/>
-|align="center"| glyceraldehyde-3-phosphate dehydrogenase
+|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 |
-*cerebral cortex during ageing
+*Cerebral cortex during ageing
-*cortex during ageing
+*Cortex during ageing
-*cerebellum during ageing
+*Cerebellum during ageing
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008084.3 '''NM_008084.3''']
 |nowrap style="font-size:9pt"|
-* F:tgcgacttcaacagcaactc
+* F:TGCGACTTCAACAGCAACTC
-* R:atgtaggcaatgaggtccac
+* R:ATGTAGGCAATGAGGTCCAC
 |align="center"| 143
 |align="center"| 60
@@ Line 208: / Line 220: @@
 |-
 |align="center"| Ppib<ref name="ref4"/>
-|align="center"| peptidylprolyl isomerase B
+|align="center"| Peptidylprolyl isomerase (Cyclophilin) B
 |
-*striatum during ageing
+*Striatum during ageing
-*cerebellum during ageing
+*Cerebellum during ageing
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_011149.2 '''NM_011149.2''']
 |nowrap style="font-size:9pt"|
-* F:cagcaagttccatcgtgtca
+* F:CAGCAAGTTCCATCGTGTCA
-* R:gatgctctttcctcctgtgc
+* R:GATGCTCTTTCCTCCTGTGC
 |align="center"| 85
 |align="center"| 60
@@ Line 221: / Line 233: @@
 |-
 |align="center"| Hprt<ref name="ref4"/>
-|align="center"| hypoxanthine guanine phosphoribosyl transferase
+|align="center"| Hypoxanthine guanine phosphoribosyl transferase
 |
-*hippocampus during ageing
+*Hippocampus during ageing
-*cerebellum during ageing
+*Cerebellum during ageing
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013556.2 '''NM_013556.2''']
 |nowrap style="font-size:9pt"|
-* F:ctttgctgacctgctggatt
+* F:CTTTGCTGACCTGCTGGATT
-* R:tatgtcccccgttgactgat
+* R:TATGTCCCCCGTTGACTGAT
 |align="center"| 121
 |align="center"| 60
@@ Line 234: / Line 246: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 244: / Line 256: @@
 *'''Name''': B.D.Roussel
 *'''Email''': broussel@cyceron.fr
-*'''Institute''': INSERM, INSERM U919, Serine Proteases and Pathophysiology of the Neurovascular Unit, GIP CYCERON, University Caen Basse Normandie, boulevard Becquerel, 14074 Caen, France
+*'''Institution''': INSERM, INSERM U919, Serine Proteases and Pathophysiology of the Neurovascular Unit, GIP CYCERON, University Caen Basse Normandie, boulevard Becquerel, 14074 Caen, France
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=1382777012639468795&as_sdt=2005&sciodt=0,5&hl=en '''6'''] (Based on Google Scholar [2017-09-01])
-=='''During Mouse Lung Development'''==
+=='''''Lung Development'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 260: / Line 274: @@
 |-
 |align="center"| Tuba1a<ref name="ref5"/>
-|align="center"| alpha 1a tubulin
+|align="center"| Alpha 1a tubulin
 |
-*During different stages of lung development
+*Different stages of lung development
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_011653 '''NM_011653 ''']
 |nowrap style="font-size:9pt"|
@@ Line 272: / Line 286: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 281: / Line 295: @@
 *'''Name''': Guillermo Barreto
 *'''Email''': guillermo.barreto@mpi-bn.mpg.de
-*'''Institute''': LOEWE Research Group Lung Cancer Epigenetic, Max-Planck-Institute for Heart and Lung Research, Parkstraße 1, 61231 Bad Nauheim, Germany
+*'''Institution''': LOEWE Research Group Lung Cancer Epigenetic, Max-Planck-Institute for Heart and Lung Research, Parkstraße 1, 61231 Bad Nauheim, Germany
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=17284368679653769355&as_sdt=2005&sciodt=0,5&hl=en '''7'''] (Based on Google Scholar [2017-09-01])
-=='''Epithelial and Nonepithelial Cells of Small Intestine'''==
+=='''''Epithelial & Nonepithelial Cells'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 299: / Line 315: @@
 |align="center"| Beta-glucuronidase
 |
-* mouse small intestine
+* Eepithelial cells isolated from the mouse intestine
+* Eepithelial cells isolated the IEC6 cell line
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_010368 '''NM_010368''']
 |nowrap style="font-size:9pt"|
@@ Line 309: / Line 326: @@
 |-
 |align="center"| TBP<ref name="ref6"/>
-|align="center"| TATAA-box binding protein
+|align="center"| TATA-box binding protein
 |
-* mouse small intestine
+* Eepithelial cells isolated from the mouse intestine
+* Eepithelial cells isolated the IEC6 cell line
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008907 '''NM_008907''']
 |nowrap style="font-size:9pt"|
@@ Line 320: / Line 338: @@
 |align="center"| SYBR
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 330: / Line 349: @@
 *'''Name''': Yongping Su
 *'''Email''': suyp2003@yahoo.com.cn
-*'''Institute''': Institute of Combined Injury, State Key Laboratory of Trauma, Burns and Combined Injury, College of Preventive Medicine, Third Military Medical University, 30 Gaotanyan Road, Shapingba District, Chongqing 400038, China
+*'''Institution''': Institute of Combined Injury, State Key Laboratory of Trauma, Burns and Combined Injury, College of Preventive Medicine, Third Military Medical University, 30 Gaotanyan Road, Shapingba District, Chongqing 400038, China
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=15259891202787233691&as_sdt=2005&sciodt=0,5&hl=en '''55'''] (Based on Google Scholar [2017-09-01])
-=='''Preimplantation Embryos'''==
+=='''''Preimplantation Embryos'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! style="width=15%　font-size:9pt　"|Gene name
+! style="width=15%　font-size:9pt　"|Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 349: / Line 370: @@
 |
 * B6D2F-1 and C57BL/6 strains
-* blastocyst embryonic stages cultured in KSOM medium
+* Blastocyst embryonic stages cultured in KSOM medium
 *KOSOM and CZB cultures of B6D2F-1 and C57BL/6 strain-derived embryos
-* zygote stage embryos
+* Zygote stage embryos
 *2-cell, 4-cell, 8-cell stage embryos cultured in M16 medium
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_016750 '''NM_016750 ''']
@@ Line 362: / Line 383: @@
 |-
 |align="center"| sptbn<ref name="ref7"/>
-|align="center"| pectrin beta, non-erythrocytic 1
+|align="center"| Pectrin beta, non-erythrocytic 1
 |
 * ICR strain-derived embryos
@@ Line 379: / Line 400: @@
 * C57BL/6 strain-derived embryos
 * 2-cell, 4-cell stage embryos cultured in CZB medium
-* blastocyst stage embryos cultured in M16 medium
+* Blastocyst stage embryos cultured in M16 medium
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_030215 '''NM_030215 ''']
 |nowrap style="font-size:9pt"|
@@ Line 389: / Line 410: @@
 |-
 |align="center"| ywhaz<ref name="ref7"/>
-|align="center"| ywhaz
+|align="center"| 14-3-3 protein zeta/delta (14-3-3ζ)
 |
-* zygote & molular embryonic stages cultured in KSOM medium
+* Zygote & molular embryonic stages cultured in KSOM medium
-*molular stage embryos cultured in CZB medium
+*Molular stage embryos cultured in CZB medium
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_001253807 '''NM_001253807''']
 |nowrap style="font-size:9pt"|
@@ Line 402: / Line 423: @@
 |-
 |align="center"| tgfb1<ref name="ref7"/>
-|align="center"| transforming growth factor, beta 1
+|align="center"| Transforming growth factor, beta 1
 |
 * 2-cell embryonic stages cultured in KSOM medium
@@ Line 417: / Line 438: @@
 |
 * 4-cell, 8-cell embryonic stages cultured in KSOM medium
-* zygote embryos cultured in M16 medium
+* Zygote embryos cultured in M16 medium
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/X00686 '''X00686 ''']
 |nowrap style="font-size:9pt"|
@@ Line 427: / Line 448: @@
 |-
 |align="center"| actb<ref name="ref7"/>
-|align="center"| actin, beta
+|align="center"| β-actin
 |
 * 8-cell stage embryos cultured in M16 medium
@@ Line 439: / Line 460: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 448: / Line 469: @@
 *'''Name''': Jin-Hoi Kim
 *'''Email''': jhkim541@konkuk.ac.kr
-*'''Institute''': Department of Animal Biotechnology, KonKuk University, Seoul 143-701, Republic of Korea
+*'''Institution''': Department of Animal Biotechnology, KonKuk University, Seoul 143-701, Republic of Korea
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=3344230699377018626&as_sdt=2005&sciodt=0,5&hl=en '''4'''] (Based on Google Scholar [2017-09-01])
-=='''Embryonic and Extra Embryonic Stem Cells'''==
+=='''''Embryonic Stem Cells'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 464: / Line 487: @@
 |-
 |align="center"| Pgk1<ref name="ref8"/>
-|align="center"| phosphoglycerate kinase 1
+|align="center"| Phosphoglycerate kinase 1
 |
-* between ES, TS and XEN stem cells
+* ES, TS and XEN stem cells
-* the in vitro differentiation of embryonic and trophectoderm stem cells
+* In vitro differentiation of embryonic and trophectoderm stem cells
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008828 '''NM_008828''']
 |nowrap style="font-size:9pt"|
@@ Line 479: / Line 502: @@
 |align="center"| Succinate dehydrogenase complex, subunit A
 |
-* between ES, TS and XEN stem cells
+* ES, TS and XEN stem cells
-* the in vitro differentiation of embryonic and trophectoderm stem cells
+* In vitro differentiation of embryonic and trophectoderm stem cells
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/BC011301 '''BC011301''']
 |nowrap style="font-size:9pt"|
@@ Line 492: / Line 515: @@
 |align="center"| TATA box binding protein
 |
-* between ES, TS and XEN stem cells
+* ES, TS and XEN stem cells
-* the in vitro differentiation of embryonic and trophectoderm stem cells
+* In vitro differentiation of embryonic and trophectoderm stem cells
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013684 '''NM_013684''']
 |nowrap style="font-size:9pt"|
@@ Line 505: / Line 528: @@
 |align="center"| Tyrosine 3-monooxygenase /tryptophan 5-monooxygenase activation protein, zeta polypeptide
 |
-* the in vitro differentiation of embryonic and trophectoderm stem cells
+* In vitro differentiation of embryonic and trophectoderm stem cells
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013684 '''NM_013684''']
 |nowrap style="font-size:9pt"|
@@ Line 515: / Line 538: @@
 |-
 |align="center"| Hk2<ref name="ref8"/>
-|align="center"| hexokinase 2
+|align="center"| Hexokinase 2
 |
-* the in vitro differentiation of embryonic and trophectoderm stem cells
+* In vitro differentiation of embryonic and trophectoderm stem cells
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_011740 '''NM_011740''']
 |nowrap style="font-size:9pt"|
@@ Line 526: / Line 549: @@
 |align="center"| SYBR
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 537: / Line 561: @@
 *'''Name''': Michael C. Golding
 *'''Email''': mgolding@cvm.tamu.edu
-*'''Institute''': College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas, United States of America
+*'''Institution''': College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas, United States of America
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=10119274701109814464&as_sdt=2005&sciodt=0,5&hl=en '''42'''] (Based on Google Scholar [2017-09-01])
-=='''Mouse Model of Obesity'''==
+=='''''Obesity Model'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 555: / Line 581: @@
 |align="center"| Beta 2 Microglobulin
 |
-* liver of monosodium glutamate (MSG)-injected mice with developed central obesity
+* Liver of monosodium glutamate (MSG)-injected mice with developed central obesity
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_009735 '''NM_009735''']
 |nowrap style="font-size:9pt"|
@@ Line 567: / Line 593: @@
 |align="center"| 18S Ribosomal RNA
 |
-* liver of monosodium glutamate (MSG)-injected mice with developed central obesity
+* Liver of monosodium glutamate (MSG)-injected mice with developed central obesity
-* small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
+* Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NR_003278 '''NR_003278''']
 |nowrap style="font-size:9pt"|
@@ Line 580: / Line 606: @@
 |align="center"| Hypoxanthine phosphoribosyl transferase
 |
-*liver of monosodium glutamate (MSG)-injected mice with developed central obesity
+*Liver of monosodium glutamate (MSG)-injected mice with developed central obesity
-* small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
+* Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013556 '''NM_013556''']
 |nowrap style="font-size:9pt"|
@@ Line 593: / Line 619: @@
 |align="center"| Ribosomal Protein large P0
 |
-* small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
+* Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/254939638/ '''NM_007475''']
 |nowrap style="font-size:9pt"|
@@ Line 603: / Line 629: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 614: / Line 640: @@
 *'''Name''': Petra Matoušková
 *'''Email''': matousp7@faf.cuni.cz
-*'''Institute''': Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic
+*'''Institution''': Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=2461273527433039566&as_sdt=2005&sciodt=0,5&hl=en '''26'''] (Based on Google Scholar [2017-09-01])
-=='''Testis Development'''==
+=='''''Testis Development'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 630: / Line 658: @@
 |-
 |align="center"| Ppia<ref name="ref10"/>
-|align="center"| peptidylprolyl isomerase A
+|align="center"| Peptidylprolyl isomerase (Cyclophilin) A
 |
-* testis development
+* Testis development
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008907 '''NM_008907''']
 |nowrap style="font-size:9pt"|
@@ Line 642: / Line 670: @@
 |-
 |align="center"| Gapdh<ref name="ref10"/>
-|align="center"| glyceraldehyde-3-phosphate dehydrogenase
+|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 |
-* testis development
+* Testis development
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008084 '''NM_008084''']
 |nowrap style="font-size:9pt"|
@@ Line 654: / Line 682: @@
 |-
 |align="center"| Actb<ref name="ref10"/>
-|align="center"| beta actin
+|align="center"| β-Actin
 |
-* testis development
+* Testis development
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_007393 '''NM_007393''']
 |nowrap style="font-size:9pt"|
@@ Line 666: / Line 694: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 679: / Line 707: @@
 *'''Name''': Wen Zhen Lin
 *'''Email''': linwenzhen@msn.com
-*'''Institute''': Department of Biochemistry and Molecular Biology, School of Preclinical Sciences, Guangxi Medical University, Nanning 530021, Guangxi, China
+*'''Institution''': Department of Biochemistry and Molecular Biology, School of Preclinical Sciences, Guangxi Medical University, Nanning 530021, Guangxi, China
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=16514510807151339812&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
-=='''Intestinal Epithelial Cells'''==
+=='''''Intestinal Epithelial Cells'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 695: / Line 725: @@
 |-
 |align="center"| Ppib<ref name="ref11"/>
-|align="center"| Peptidylprolyl isomerase B
+|align="center"| Peptidylprolyl isomerase (Cyclophilin) B
 |
 * Univeral reference gene in the differentiated fraction
@@ Line 707: / Line 737: @@
 |-
 |align="center"| Ppia<ref name="ref11"/>
-|align="center"| Peptidyl-prolyl cis–trans isomerase A
+|align="center"| Peptidyl-prolyl cis–trans isomerase (Cyclophilin) A
 |
-* proliferating intestinal compartments and IEC6 cells
+* Proliferating intestinal compartments and IEC6 cells
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008907.1 '''NM_008907.1''']
 |nowrap style="font-size:9pt"|
@@ Line 730: / Line 760: @@
 |align="center"| SYBR
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 740: / Line 771: @@
 *'''Name''': Maria Sirakov
 *'''Email''': maria.sirakov@ulb.ac.be
-*'''Institute''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies, Belgium
+*'''Institution''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies, Belgium
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=6555526528695445385&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01])
-=='''Mouse Skeletal Muscle'''==
+=='''''Skeletal Muscle & Different Genotypes'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 756: / Line 789: @@
 |-
 |align="center"| Rpl27<ref name="ref12"/>
-|align="center"| ribosomal protein L27
+|align="center"| Ribosomal protein L27
 |
 *R129 strain
@@ Line 770: / Line 803: @@
 |align="center"| Retention in endoplasmic reticulum 1 protein
 |
-*R129 strain & C57BL/6j strain & C57BL/10 strain
+*R129 strain
+*C57BL/6j strain
+*C57BL/10 strain
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_026395 '''NM_026395''']
 |nowrap style="font-size:9pt"|
@@ Line 780: / Line 815: @@
 |-
 |align="center"| Rpl41<ref name="ref12"/>
-|align="center"| ribosomal protein L41
+|align="center"| Ribosomal protein L41
 |
 *R129 strain and Rpl7l1
-*C57BL/6j
+*C57BL/6j strain
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_018860 '''NM_018860''']
 |nowrap style="font-size:9pt"|
@@ Line 793: / Line 828: @@
 |-
 |align="center"| Rpl7l1<ref name="ref12"/>
-|align="center"| ribosomal protein L7-like 1
+|align="center"| Ribosomal protein L7-like 1
 |
-*C57BL/6j strain & C57BL/10 strain
+*C57BL/6j strain
+*C57BL/10 strain
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_025433 '''NM_025433''']
 |nowrap style="font-size:9pt"|
@@ Line 805: / Line 841: @@
 |-
 |align="center"| Aldoa<ref name="ref12"/>
-|align="center"| aldolase A, fructose-bisphosphate
+|align="center"| Aldolase A, fructose-bisphosphate
 |
 *C57BL/10 strain
@@ Line 816: / Line 852: @@
 |align="center"| SYBR
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 825: / Line 862: @@
 *'''Name''': Kathryn N. North
 *'''Email''': Kathryn.north@mcri.edu.au
-*'''Institute''': Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic
+*'''Institution''': Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=1062620161022216578&as_sdt=2005&sciodt=0,5&hl=en '''12'''] (Based on Google Scholar [2017-09-01])
 =='''References'''==
@@ Line 876: / Line 915: @@
 Thomas K C, Zheng X F, Suarez F G, et al. Evidence based selection of commonly used RT-qPCR reference genes for the analysis of mouse skeletal muscle[J]. PloS one, 2014, 9(2): e88653.
 </ref>
+</references>
+=='''Categories'''==
+[[Category:Animals]]
+[[Category:mRNA]]
+[[Category:SYBR]]
+[[Category:18S rRNA]] [[Category:18S rRNA]] [[Category:ACT]] [[Category:ACT]] [[Category:Aldoa]] [[Category:B2M]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GUSB]] [[Category:Histone]] [[Category:HK]] [[Category:HPRT]] [[Category:HPRT]] [[Category:HPRT]] [[Category:PGK]] [[Category:Cyclophilin]] [[Category:Rer1]] [[Category:RPL]] [[Category:SDHA]] [[Category:SPTBN]] [[Category:TBP]] [[Category:TBP]] [[Category:TBP]] [[Category:TGFB]] [[Category:Tubulin]] [[Category:WRNIP]] [[Category:YWHAZ]] [[Category:YWHAZ]][[Category:Different Tissues]]  [[Category:Animal Model]]  [[Category:Ageing]]  [[Category:Lung Development]]  [[Category:Specific Tissue]]  [[Category:Specific Cells]]  [[Category:Different Genotypes]]  [[Category:Pathological conditions]]
+{{Template:BackToTop}}
-</references>
+[[Category:geNorm]]
+[[Category:NormFinder]]
+[[Category:BestKeeper]]
+[[Category:Delta Ct]]
+[[Category:RefFinder]]

Difference between revisions of "Mus musculus"

Latest revision as of 07:41, 7 September 2017

Contents

Description

Dextran Sodium Sulfate Experimental Colitis

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Mammary Glands

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Uterus in the Peri-Implantation Period

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Different Tissues & Ageing

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Lung Development

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Epithelial & Nonepithelial Cells

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Preimplantation Embryos

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Embryonic Stem Cells

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Obesity Model

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Testis Development

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Intestinal Epithelial Cells

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Skeletal Muscle & Different Genotypes

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

References

Categories

Navigation menu

Search