Difference between revisions of "Mus musculus"

From ICG
Jump to navigation Jump to search
 
(44 intermediate revisions by 4 users not shown)
Line 7: Line 7:
 
=='''''Dextran Sodium Sulfate Experimental Colitis'''''==
 
=='''''Dextran Sodium Sulfate Experimental Colitis'''''==
  
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 56: Line 56:
 
*'''Institution''': Immunology, University of Manitoba, Winnipeg, MB, Canada
 
*'''Institution''': Immunology, University of Manitoba, Winnipeg, MB, Canada
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''3''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=15094739600394943508&as_sdt=2005&sciodt=0,5&hl=en '''3''' ](Based on Google Scholar [2017-09-01])
  
 
=='''''Mammary Glands'''''==
 
=='''''Mammary Glands'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt;width:100%;"
 
{|class="wikitable sortable" style="font-size:10pt;width:100%;"
 
|-
 
|-
Line 74: Line 74:
 
|align="center"| Hypoxanthine guanine phosphoribosyl transferase
 
|align="center"| Hypoxanthine guanine phosphoribosyl transferase
 
|
 
|
−
* Mammary glands
+
* Mouse mammary glands
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013556 '''NM_013556''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013556 '''NM_013556''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 86: Line 86:
 
|align="center"| Ribosomal protein L13A
 
|align="center"| Ribosomal protein L13A
 
|
 
|
−
* Mammary glands
+
* Mouse mammary glands
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_009438 '''NM_009438''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_009438 '''NM_009438''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 98: Line 98:
 
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
−
* Mammary glands
+
* Mouse mammary glands
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008084 '''NM_008084''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008084 '''NM_008084''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 119: Line 119:
 
*'''Institution''': College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou, China
 
*'''Institution''': College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''11''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=3139211935715979100&as_sdt=2005&sciodt=0,5&hl=en '''11'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Uterus in the Peri-Implantation Period'''''==
 
=='''''Uterus in the Peri-Implantation Period'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 176: Line 176:
 
*'''Institution''': College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi, China
 
*'''Institution''': College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''28''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=1151953663364672682&as_sdt=2005&sciodt=0,5&hl=en '''28''']  (Based on Google Scholar [2017-09-01])
  
 
=='''''Different Tissues & Ageing'''''==
 
=='''''Different Tissues & Ageing'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 258: Line 258:
 
*'''Institution''': INSERM, INSERM U919, Serine Proteases and Pathophysiology of the Neurovascular Unit, GIP CYCERON, University Caen Basse Normandie, boulevard Becquerel, 14074 Caen, France
 
*'''Institution''': INSERM, INSERM U919, Serine Proteases and Pathophysiology of the Neurovascular Unit, GIP CYCERON, University Caen Basse Normandie, boulevard Becquerel, 14074 Caen, France
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''4''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=1382777012639468795&as_sdt=2005&sciodt=0,5&hl=en '''6'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Lung Development'''''==
 
=='''''Lung Development'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 297: Line 297:
 
*'''Institution''': LOEWE Research Group Lung Cancer Epigenetic, Max-Planck-Institute for Heart and Lung Research, Parkstraße 1, 61231 Bad Nauheim, Germany
 
*'''Institution''': LOEWE Research Group Lung Cancer Epigenetic, Max-Planck-Institute for Heart and Lung Research, Parkstraße 1, 61231 Bad Nauheim, Germany
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''7''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=17284368679653769355&as_sdt=2005&sciodt=0,5&hl=en '''7'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Epithelial & Nonepithelial Cells'''''==
 
=='''''Epithelial & Nonepithelial Cells'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 315: Line 315:
 
|align="center"| Beta-glucuronidase
 
|align="center"| Beta-glucuronidase
 
|
 
|
−
* Mouse small intestine
+
* Eepithelial cells isolated from the mouse intestine  
 +
* Eepithelial cells isolated the IEC6 cell line
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_010368 '''NM_010368''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_010368 '''NM_010368''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 327: Line 328:
 
|align="center"| TATA-box binding protein
 
|align="center"| TATA-box binding protein
 
|
 
|
−
* Mouse small intestine
+
* Eepithelial cells isolated from the mouse intestine  
 +
* Eepithelial cells isolated the IEC6 cell line
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008907 '''NM_008907''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_008907 '''NM_008907''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 349: Line 351:
 
*'''Institution''': Institute of Combined Injury, State Key Laboratory of Trauma, Burns and Combined Injury, College of Preventive Medicine, Third Military Medical University, 30 Gaotanyan Road, Shapingba District, Chongqing 400038, China
 
*'''Institution''': Institute of Combined Injury, State Key Laboratory of Trauma, Burns and Combined Injury, College of Preventive Medicine, Third Military Medical University, 30 Gaotanyan Road, Shapingba District, Chongqing 400038, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''52''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=15259891202787233691&as_sdt=2005&sciodt=0,5&hl=en '''55'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Preimplantation Embryos'''''==
 
=='''''Preimplantation Embryos'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 469: Line 471:
 
*'''Institution''': Department of Animal Biotechnology, KonKuk University, Seoul 143-701, Republic of Korea
 
*'''Institution''': Department of Animal Biotechnology, KonKuk University, Seoul 143-701, Republic of Korea
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''4''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=3344230699377018626&as_sdt=2005&sciodt=0,5&hl=en '''4'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Embryonic Stem Cells'''''==
 
=='''''Embryonic Stem Cells'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 561: Line 563:
 
*'''Institution''': College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas, United States of America
 
*'''Institution''': College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas, United States of America
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''41''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=10119274701109814464&as_sdt=2005&sciodt=0,5&hl=en '''42'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Obesity Model'''''==
 
=='''''Obesity Model'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 640: Line 642:
 
*'''Institution''': Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic
 
*'''Institution''': Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''24''' (Based on Google Scholar [2017-06-23])
+
Cited by [https://scholar.google.com/scholar?cites=2461273527433039566&as_sdt=2005&sciodt=0,5&hl=en '''26'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Testis Development'''''==
 
=='''''Testis Development'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 656: Line 658:
 
|-
 
|-
 
|align="center"| Ppia<ref name="ref10"/>
 
|align="center"| Ppia<ref name="ref10"/>
−
|align="center"| Peptidylprolyl isomerase A
+
|align="center"| Peptidylprolyl isomerase (Cyclophilin) A
 
|
 
|
 
* Testis development
 
* Testis development
Line 707: Line 709:
 
*'''Institution''': Department of Biochemistry and Molecular Biology, School of Preclinical Sciences, Guangxi Medical University, Nanning 530021, Guangxi, China
 
*'''Institution''': Department of Biochemistry and Molecular Biology, School of Preclinical Sciences, Guangxi Medical University, Nanning 530021, Guangxi, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''8''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16514510807151339812&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Intestinal Epithelial Cells'''''==
 
=='''''Intestinal Epithelial Cells'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 723: Line 725:
 
|-
 
|-
 
|align="center"| Ppib<ref name="ref11"/>
 
|align="center"| Ppib<ref name="ref11"/>
−
|align="center"| Peptidylprolyl isomerase B
+
|align="center"| Peptidylprolyl isomerase (Cyclophilin) B
 
|
 
|
 
* Univeral reference gene in the differentiated fraction
 
* Univeral reference gene in the differentiated fraction
Line 735: Line 737:
 
|-
 
|-
 
|align="center"| Ppia<ref name="ref11"/>
 
|align="center"| Ppia<ref name="ref11"/>
−
|align="center"| Peptidyl-prolyl cis–trans isomerase A
+
|align="center"| Peptidyl-prolyl cis–trans isomerase (Cyclophilin) A
 
|
 
|
 
* Proliferating intestinal compartments and IEC6 cells
 
* Proliferating intestinal compartments and IEC6 cells
Line 758: Line 760:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
 +
 
===Molecular Types===
 
===Molecular Types===
 
* mRNA
 
* mRNA
Line 770: Line 773:
 
*'''Institution''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies, Belgium
 
*'''Institution''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies, Belgium
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''4''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=6555526528695445385&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Skeletal Muscle & Different Genotypes'''''==
 
=='''''Skeletal Muscle & Different Genotypes'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 861: Line 864:
 
*'''Institution''': Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic
 
*'''Institution''': Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''11''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=1062620161022216578&as_sdt=2005&sciodt=0,5&hl=en '''12'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 913: Line 916:
 
</ref>
 
</ref>
 
</references>
 
</references>
−
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
−
[[Category:18S rRNA]] [[Category:18S rRNA]] [[Category:ACT]] [[Category:ACT]] [[Category:Aldoa]] [[Category:B7M]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GUSB]] [[Category:Histone]] [[Category:HK]] [[Category:HPRT]] [[Category:HPRT]] [[Category:HPRT]] [[Category:PGK]] [[Category:PPI]] [[Category:PPI]] [[Category:PPI]] [[Category:PPI]] [[Category:Rer1]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:SDHA]] [[Category:SPTBN]] [[Category:TBP]] [[Category:TBP]] [[Category:TBP]] [[Category:TGFB]] [[Category:Tubulin]] [[Category:WRNIP]] [[Category:YWHAZ]] [[Category:YWHAZ]][[Category:Different Tissues]]  [[Category:Animal Model]]  [[Category:Ageing]]  [[Category:Lung Development]]  [[Category:Specific Tissue]]  [[Category:Specific Cells]]  [[Category:Different Genotypes]]  [[Category:Pathological conditions]]
+
[[Category:18S rRNA]] [[Category:18S rRNA]] [[Category:ACT]] [[Category:ACT]] [[Category:Aldoa]] [[Category:B2M]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GUSB]] [[Category:Histone]] [[Category:HK]] [[Category:HPRT]] [[Category:HPRT]] [[Category:HPRT]] [[Category:PGK]] [[Category:Cyclophilin]] [[Category:Rer1]] [[Category:RPL]] [[Category:SDHA]] [[Category:SPTBN]] [[Category:TBP]] [[Category:TBP]] [[Category:TBP]] [[Category:TGFB]] [[Category:Tubulin]] [[Category:WRNIP]] [[Category:YWHAZ]] [[Category:YWHAZ]][[Category:Different Tissues]]  [[Category:Animal Model]]  [[Category:Ageing]]  [[Category:Lung Development]]  [[Category:Specific Tissue]]  [[Category:Specific Cells]]  [[Category:Different Genotypes]]  [[Category:Pathological conditions]]
 
{{Template:BackToTop}}
 
{{Template:BackToTop}}
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 07:41, 7 September 2017

Contents

Description

Mus musculus.png
  • Mus musculus is a small mammal of the order Rodentia, characteristically having a pointed snout, small rounded ears, and a long naked or almost hairless tail. It is one of the most numerous species of the genus Mus. Although a wild animal, the house mouse mainly lives in association with humans (Modified from Wikipedia).
  • Common Name: Mouse
  • NCBI Taxonomy

Dextran Sodium Sulfate Experimental Colitis

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
Tbp[1] TATA-box-binding protein
  • Mouse dextran sodium sulfate experimental colitis
 NM_013684
  • F:ACCGTGAATCTTGGCTGTAAAC
  • R:GCAGCAAATCGCTTGGGATTA
 86 60.8~61.3 SYBR
Eef2[1] Eukaryotic Translation Elongation Factor 2
  • Mouse dextran sodium sulfate experimental colitis
 NM_007907.2
  • F:TGTCAGTCATCGCCCATGTG
  • R:CATCCTTGCGAGTGTCAGTGA
 123 62.1~62.2 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jean-Eric Ghia
  • Email: Jean-Eric.Ghia@umanitoba.ca
  • Institution: Immunology, University of Manitoba, Winnipeg, MB, Canada

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-09-01])

Mammary Glands

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
HPRT[2] Hypoxanthine guanine phosphoribosyl transferase
  • Mouse mammary glands
 NM_013556
  • F:CCTAAGATGAGCGCAAGTTGAA
  • R:CCACAGGACTAGAACACCTGCTAA
 86 60 SYBR
RPL13A[2] Ribosomal protein L13A
  • Mouse mammary glands
 NM_009438
  • F:CCTAAGATGAGCGCAAGTTGAA
  • R:CCACAGGACTAGAACACCTGCTAA
 168 60 SYBR
GAPDH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • Mouse mammary glands
 NM_008084
  • F:TGTGTCCGTCGTGGATCTGA
  • R:TTGCTGTTGAAGTCGCAGGAG
 150 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Y.L. Wang
  • Email: ylwang2001@yahoo.cn
  • Institution: College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou, China

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-09-01])

Uterus in the Peri-Implantation Period

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
RPLP0[3] Ribosomal protein, large, P0
  • Early pregnancy, pseudopregnancy, delayed implantation
  • Activation, artificial decidualization
  • Hormonal treatment model
 NM_007475
  • F:GGACCCGAGAAGACCTCCTT
  • R:GCACATCACTCAGAATTTCAATGG
 85 60 SYBR
GAPDH[3] Glyceraldehydes-3-phosphate dehydrogenase
  • Early pregnancy, pseudopregnancy, delayed implantation
  • Activation, artificial decidualization
  • Hormonal treatment model
 NM_008084
  • F:TCACTGCCACCCAGAAGA
  • R:GACGGACACATTGGGGGTAG
 186 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: AiHua Wang
  • Email: pflin2001n@163.com
  • Institution: College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi, China

Citation Statistics

Cited by 28 (Based on Google Scholar [2017-09-01])

Different Tissues & Ageing

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
Rpl13a[4] Ribosomal protein L13a
  • Cerebral cortex during ageing
  • Cortex during ageing
  • Hippocampus during ageing
 NM_009438.5
  • F:TACGCTGTGAAGGCATCAAC
  • R:GGGAGGGGTTGGTATTCATC
 96 60 SYBR
GAPDH[4] Glyceraldehyde-3-phosphate dehydrogenase
  • Cerebral cortex during ageing
  • Cortex during ageing
  • Cerebellum during ageing
 NM_008084.3
  • F:TGCGACTTCAACAGCAACTC
  • R:ATGTAGGCAATGAGGTCCAC
 143 60 SYBR
Ppib[4] Peptidylprolyl isomerase (Cyclophilin) B
  • Striatum during ageing
  • Cerebellum during ageing
 NM_011149.2
  • F:CAGCAAGTTCCATCGTGTCA
  • R:GATGCTCTTTCCTCCTGTGC
 85 60 SYBR
Hprt[4] Hypoxanthine guanine phosphoribosyl transferase
  • Hippocampus during ageing
  • Cerebellum during ageing
 NM_013556.2
  • F:CTTTGCTGACCTGCTGGATT
  • R:TATGTCCCCCGTTGACTGAT
 121 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: B.D.Roussel
  • Email: broussel@cyceron.fr
  • Institution: INSERM, INSERM U919, Serine Proteases and Pathophysiology of the Neurovascular Unit, GIP CYCERON, University Caen Basse Normandie, boulevard Becquerel, 14074 Caen, France

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

Lung Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
Tuba1a[5] Alpha 1a tubulin
  • Different stages of lung development
 NM_011653
  • F:CCGCGAAGCAGCAACCAT
  • R:CCAGGTCTACGAACACTGCC
 227 60.39~61.43 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Guillermo Barreto
  • Email: guillermo.barreto@mpi-bn.mpg.de
  • Institution: LOEWE Research Group Lung Cancer Epigenetic, Max-Planck-Institute for Heart and Lung Research, Parkstraße 1, 61231 Bad Nauheim, Germany

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

Epithelial & Nonepithelial Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
GUSB[6] Beta-glucuronidase
  • Eepithelial cells isolated from the mouse intestine
  • Eepithelial cells isolated the IEC6 cell line
 NM_010368
  • F:CCGATTATCCAGAGCGAGTATG
  • R:CTCAGCGGTGACTGGTTCG
 197 55–60 SYBR
TBP[6] TATA-box binding protein
  • Eepithelial cells isolated from the mouse intestine
  • Eepithelial cells isolated the IEC6 cell line
 NM_008907
  • F:CAAACCCAGAATTGTTCTCCTT
  • R:ATGTGGTCTTCCTGAATCCCT
 131 55–60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yongping Su
  • Email: suyp2003@yahoo.com.cn
  • Institution: Institute of Combined Injury, State Key Laboratory of Trauma, Burns and Combined Injury, College of Preventive Medicine, Third Military Medical University, 30 Gaotanyan Road, Shapingba District, Chongqing 400038, China

Citation Statistics

Cited by 55 (Based on Google Scholar [2017-09-01])

Preimplantation Embryos

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
h2afz[7] H2A histone family, member Z
  • B6D2F-1 and C57BL/6 strains
  • Blastocyst embryonic stages cultured in KSOM medium
  • KOSOM and CZB cultures of B6D2F-1 and C57BL/6 strain-derived embryos
  • Zygote stage embryos
  • 2-cell, 4-cell, 8-cell stage embryos cultured in M16 medium
 NM_016750
  • F:GTGGACTGTATCTCTGTGAA
  • R:GGTTGGTTGGAAGGCTAA
 89 60 SYBR
sptbn[7] Pectrin beta, non-erythrocytic 1
  • ICR strain-derived embryos
 NM_175836
  • F:TCTAATGGTTACTTGCTTGT
  • R:CAATAGTTACAGTGACAGAGA
 101 55 SYBR
wrnip[7] Werner helicase interacting protein 1
  • M16 culture of B6D2F-1
  • C57BL/6 strain-derived embryos
  • 2-cell, 4-cell stage embryos cultured in CZB medium
  • Blastocyst stage embryos cultured in M16 medium
 NM_030215
  • F:ATGAGTAGGATGCTTGTA
  • R:TAACCACCTCCATCTATG
 130 56 SYBR
ywhaz[7] 14-3-3 protein zeta/delta (14-3-3ζ)
  • Zygote & molular embryonic stages cultured in KSOM medium
  • Molular stage embryos cultured in CZB medium
 NM_001253807
  • F:CAGTAGATGGAGAAAGATTTGC
  • R:GGGACAATTAGGGAAGTAAGT
 92 60 SYBR
tgfb1[7] Transforming growth factor, beta 1
  • 2-cell embryonic stages cultured in KSOM medium
 NM_011577
  • F:TATACTGAGACACCTTGG
  • R:GTGATAGTCCTGAATAATTTG
 83 55 SYBR
18s[7] 18S rRNA
  • 4-cell, 8-cell embryonic stages cultured in KSOM medium
  • Zygote embryos cultured in M16 medium
 X00686
  • F:CGCCGCTAGAGGTGAAATTCT
  • R:CGAACCTCCGACTTTCGTTCT
 102 60 SYBR
actb[7] β-actin
  • 8-cell stage embryos cultured in M16 medium
 NM_007393
  • F:ATCTTCCGCCTTAATACT
  • R:GCCTTCATACATCAAGTT
 98 56 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jin-Hoi Kim
  • Email: jhkim541@konkuk.ac.kr
  • Institution: Department of Animal Biotechnology, KonKuk University, Seoul 143-701, Republic of Korea

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

Embryonic Stem Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
Pgk1[8] Phosphoglycerate kinase 1
  • ES, TS and XEN stem cells
  • In vitro differentiation of embryonic and trophectoderm stem cells
 NM_008828
  • F:CTGACTTTGGACAAGCTGGACG
  • R:GCAGCCTTGATCCTTTGGTTG
 110 60 SYBR
Sdha[8] Succinate dehydrogenase complex, subunit A
  • ES, TS and XEN stem cells
  • In vitro differentiation of embryonic and trophectoderm stem cells
 BC011301
  • F:GCTCCTGCCTCTGTGGTTGA
  • R:AGCAACACCGATGAGCCTG
 134 60 SYBR
Tbp[8] TATA box binding protein
  • ES, TS and XEN stem cells
  • In vitro differentiation of embryonic and trophectoderm stem cells
 NM_013684
  • F:GAAGAACAATCCAGACTAGCAGCA
  • R:CCTTATAGGGAACTTCACATCACAG
 127 60 SYBR
Ywhaz[8] Tyrosine 3-monooxygenase /tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • In vitro differentiation of embryonic and trophectoderm stem cells
 NM_013684
  • F:TTGATCCCCAATGCTTCGC
  • R:CAGCAACCTCGGCCAAGTAA
 88 60 SYBR
Hk2[8] Hexokinase 2
  • In vitro differentiation of embryonic and trophectoderm stem cells
 NM_011740
  • F:CCCTGTGAAGATGTTGCCCAC
  • R:TGCCCATGTACTCAAGGAAGT
 251 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Michael C. Golding
  • Email: mgolding@cvm.tamu.edu
  • Institution: College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas, United States of America

Citation Statistics

Cited by 42 (Based on Google Scholar [2017-09-01])

Obesity Model

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
B2M[9] Beta 2 Microglobulin
  • Liver of monosodium glutamate (MSG)-injected mice with developed central obesity
 NM_009735
  • F:GGTCTTTCTGGTGCTTGTCTCA
  • R:GTTCGGCTTCCCATTCTCC
 103 83.5 SYBR
18S[9] 18S Ribosomal RNA
  • Liver of monosodium glutamate (MSG)-injected mice with developed central obesity
  • Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
 NR_003278
  • F:GGCCGTTCTTAGTTGGTGGAGCG
  • R:CTGAACGCCACTTGTCCCTC
 133 85 SYBR
HPRT1[9] Hypoxanthine phosphoribosyl transferase
  • Liver of monosodium glutamate (MSG)-injected mice with developed central obesity
  • Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
 NM_013556
  • F:CAGTCCCAGCGTCGTGATTA
  • R:GGCCTCCCATCTCCTTCATG
 167 81.5 SYBR
RPlP0[9] Ribosomal Protein large P0
  • Small intestine of monosodium glutamate (MSG)-injected mice with developed central obesity
 NM_007475
  • F:GATGGGCAACTGTACCTGACTG
  • R:CTGGGCTCCTCTTGGAATG
 136 87.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Petra Matoušková
  • Email: matousp7@faf.cuni.cz
  • Institution: Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic

Citation Statistics

Cited by 26 (Based on Google Scholar [2017-09-01])

Testis Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
Ppia[10] Peptidylprolyl isomerase (Cyclophilin) A
  • Testis development
 NM_008907
  • F:TGTGCCAGGGTGGTGACTT
  • R:CGTTTGTGTTTGGTCCAGCAT
 144 60 SYBR
Gapdh[10] Glyceraldehyde-3-phosphate dehydrogenase
  • Testis development
 NM_008084
  • F:TGTGTCCGTCGTGGATCTGA
  • R:TTGCTGTTGAAGTCGCAGGAG
 150 60 SYBR
Actb[10] β-Actin
  • Testis development
 NM_007393
  • F:CATCCGTAAAGACCTCTATGCCAAC
  • R:ATGGAGCCACCGATCCACA
 171 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Wen Zhen Lin
  • Email: linwenzhen@msn.com
  • Institution: Department of Biochemistry and Molecular Biology, School of Preclinical Sciences, Guangxi Medical University, Nanning 530021, Guangxi, China

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Intestinal Epithelial Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
Ppib[11] Peptidylprolyl isomerase (Cyclophilin) B
  • Univeral reference gene in the differentiated fraction
 NM_011149.2
  • F:CACCAATGGCTCACAGTTCTT
  • R:ATGACATCCTTCAGTGGCTTG
 156 60 SYBR
Ppia[11] Peptidyl-prolyl cis–trans isomerase (Cyclophilin) A
  • Proliferating intestinal compartments and IEC6 cells
 NM_008907.1
  • F:CCACTGTCGCTTTTCGCCGC
  • R:TGCAAACAGCTCGAAGGAGACGC
 109 60 SYBR
Gapdh[11] Glyceraldehyde-3-phosphate dehydrogenase
  • Univeral reference gene in the differentiated fraction
 XM_003945995.1
  • F:AGCAAGGACACTGAGCAAGAG
  • R:AGCAAGGACACTGAGCAAGAG
 152 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Maria Sirakov
  • Email: maria.sirakov@ulb.ac.be
  • Institution: Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies, Belgium

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

Skeletal Muscle & Different Genotypes

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
Rpl27[12] Ribosomal protein L27
  • R129 strain
 NM_011289
  • F:AAGCCGTCATCGTGAAGAACA
  • R:CTTGATCTTGGATCGCTTGGC
 143 65 SYBR
Rer1[12] Retention in endoplasmic reticulum 1 protein
  • R129 strain
  • C57BL/6j strain
  • C57BL/10 strain
 NM_026395
  • F:GCCTTGGGAATTTACCACCT
  • R:CTTCGAATGAAGGGACGAAA
 137 62 SYBR
Rpl41[12] Ribosomal protein L41
  • R129 strain and Rpl7l1
  • C57BL/6j strain
 NM_018860
  • F:GCCATGAGAGCGAAGTGG
  • R:CTCCTGCAGGCGTCGTAG
 113 65 SYBR
Rpl7l1[12] Ribosomal protein L7-like 1
  • C57BL/6j strain
  • C57BL/10 strain
 NM_025433
  • F:ACGGTGGAGCCTTATGTGAC
  • R:TCCGTCAGAGGGACTGTCTT
 110 65 SYBR
Aldoa[12] Aldolase A, fructose-bisphosphate
  • C57BL/10 strain
 NM_001177307
  • F:ACATTGCTGAAGCCCAACAT
  • R:ACAGGAAAGTGACCCCAGTG
 136 62 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kathryn N. North
  • Email: Kathryn.north@mcri.edu.au
  • Institution: Department of Biochemical Sciences, Charles University in Prague, Faculty of Pharmacy, Hradec Králové, Czech Republic

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 Eissa N, Hussein H, Wang H, et al. Stability of Reference Genes for Messenger RNA Quantification by Real-Time PCR in Mouse Dextran Sodium Sulfate Experimental Colitis[J]. PloS one, 2016, 11(5): e0156289.
  2. ↑ 2.0 2.1 2.2 Han L Q, Yang G Y, Zhu H S, et al. Selection and use of reference genes in mouse mammary glands[J]. Genet Mol Res, 2010, 9(1): 449-56.
  3. ↑ 3.0 3.1 Lin P F, Lan X L, Chen F L, et al. Reference gene selection for real-time quantitative PCR analysis of the mouse uterus in the peri-implantation period[J]. PloS one, 2013, 8(4): e62462.
  4. ↑ 4.0 4.1 4.2 4.3 Bruckert G, Vivien D, Docagne F, et al. Normalization of Reverse Transcription Quantitative PCR Data During Ageing in Distinct Cerebral Structures[J]. Molecular neurobiology, 2016, 53(3): 1540-1550.
  5. ↑ Mehta A, Dobersch S, Dammann R H, et al. Validation of Tuba1a as appropriate internal control for normalization of gene expression analysis during mouse lung development[J]. International journal of molecular sciences, 2015, 16(3): 4492-4511.
  6. ↑ 6.0 6.1 Wang F, Wang J, Liu D, et al. Normalizing genes for real-time polymerase chain reaction in epithelial and nonepithelial cells of mouse small intestine[J]. Analytical biochemistry, 2010, 399(2): 211-217.
  7. ↑ 7.0 7.1 7.2 7.3 7.4 7.5 7.6 Jeong J K, Kang M H, Gurunathan S, et al. Evaluation of reference genes in mouse preimplantation embryos for gene expression studies using real-time quantitative RT-PCR (RT-qPCR)[J]. BMC research notes, 2014, 7(1): 675.
  8. ↑ 8.0 8.1 8.2 8.3 8.4 Veazey K J, Golding M C. Selection of stable reference genes for quantitative rt-PCR comparisons of mouse embryonic and extra-embryonic stem cells[J]. PloS one, 2011, 6(11): e27592.
  9. ↑ 9.0 9.1 9.2 9.3 Matoušková P, Bártíková H, Boušová I, et al. Reference genes for real-time PCR quantification of messenger RNAs and microRNAs in mouse model of obesity[J]. PLoS One, 2014, 9(1): e86033.
  10. ↑ 10.0 10.1 10.2 Gong Z K, Wang S J, Huang Y Q, et al. Identification and validation of suitable reference genes for RT-qPCR analysis in mouse testis development[J]. Molecular genetics and genomics, 2014, 289(6): 1157-1169.
  11. ↑ 11.0 11.1 11.2 Sirakov M, Borra M, Cambuli F M, et al. Defining suitable reference genes for RT-qPCR analysis on intestinal epithelial cells[J]. Molecular biotechnology, 2013, 54(3): 930-938.
  12. ↑ 12.0 12.1 12.2 12.3 12.4 Thomas K C, Zheng X F, Suarez F G, et al. Evidence based selection of commonly used RT-qPCR reference genes for the analysis of mouse skeletal muscle[J]. PloS one, 2014, 9(2): e88653.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Mus_musculus&oldid=8879"