Musa acuminata

Description

• Banana is the second ranking fruit crop in the world,with an annual world production of 70 million metric tons. Banana fruits are the staple food of over 400 million people in the developing countries, not only as a popular dessert fruit, but also as a source of vital carbohydrate.
• Cultivated bananas and plantains are giant herbaceous plants within the genus Musa. They are both sterile and parthenocarpic so the fruit develops without seed. The cultivated hybrids and species are mostly triploid (2n = 3x = 33; a few are diploid or tetraploid), and most have been propagated from mutants found in the wild. With a production of 100 million tons annually, banana is a staple food across the Asian, African and American tropics, with the 15 % that is exported being important to many economies .

Different Experimental Conditions

Reference Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
RPS2	Ribosomal protein S 2	In 144 banana samples	HQ853246	F:TAGGGATTCCGACGATTTGTTT R:TAGCGTCATCATTGGCTGGGA	84	80.86	SYBR
UBQ2	Ubiquitin2	In 145 banana samples	HQ853254	F:GGCACCACAAACAACACAGG R:AGACGAGCAAGGCTTCCATT	379	85.58	SYBR

Moleculer Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference

Contact

• Name: Jian-ye Chen
• Email: chenjianye@scau.edu.cn
• Institute: Guangdong Key Laboratory for Postharvest Science, College of Horticultural Science, South China Agricultural University, Guangzhou 510642, People’s Republic of China

Citation Statistics

Cited by 154 (Based on Google Scholar [2017-06-16])