Neurospora crassa

Description

Neurospora crassa is a filamentous fungus classified under the phylum Ascomycota and is widely distributed in nature. It is typically found growing on vegetation killed by fire because it is able to synthesize and secrete high levels of enzyme types involved in lignocellulosic biomass degradation. It is also able to convert pentose sugars, cellulose polymers, and agro-industrial residues to ethanol. It has served as a model organism for studying circadian pathways and has gained attention from the biofuel industry due to its enhanced capacity for cellulase production^[1]^[2].
Common Name: NA
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
btl^[1]	Beta-tubulin	Light/dark cycling, all-dark growth, temperature flux	NCU04054	F:CCACTTCTTCATGGTCGGCT R:CTTGGGGTCGAACATCTGCT	103	83.21	SYBR
asl^[1]	ATP synthase lyase gamma subunit	Light/dark cycling, temperature flux	NCU09119.7	F:TACCAACGCCAAGGACATCG R:GAGTAGTCGCCCTTGAGCTG	114	81.35	SYBR
vma1^[1]	Vacuolar ATPase subunit 1	Light/dark cycling, all-dark growth, temperature flux	J03955.1	F:CCAACAAAATGGCGCCGAG R:CCAACTCATACATAGCAACACC	111	80.45	SYBR
tbp^[1]	TATA binding box protein	All-dark growth	NCU044770	F:GGTGCCAAGTCCGAAGATGA R:TGGGGAACTTGATGTCGCAA	136	79.38	SYBR
vma2^[1]	Vacuolar ATPase subunit 2	All-dark growth	J03956.1	F:GTCGTCCAGGTCTTCGAGG R:TGCCGGAACCATCAAAGATACG	127	78.90	SYBR
ACT^[1]	Beta-actin	Different temperature conditions	NCU04173	F:GATCGGTATGGGCCAGAAGG R:CGTCCCAGTTGGTAACGACA	110	79.10	SYBR

Name: Kathleen D. Cusick
Email: Kathleen_cusick.ctr@code6100.nrl.navy.mil
Institution: National Research Council Associateship, U.S. Naval Research Laboratory, Washington, District of Columbia, United States of America

Cited by 7 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 Cusick KD, Fitzgerald LA, Pirlo RK, et al. (2014) Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture. PLoS One 9, e112706
↑ Baker CL, Loros JJ, Dunlap JC (2012) The circadian clock of Neurospora crassa. Fems Microbiology Reviews 36, 95-110.